ORFeome > rpl18a ORF1 – XORFeome v1.0

rpl18a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl18a
Gene ID: 5775291
Gene Page ID: 5774783
ORF Xenbase ID: 17294157

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053761
Original XGC clone length: 531

Human orthology & disease relationships

NCBI Entrez ID: 6142
Ensembl gene IDs: ENSG00000105640
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11001
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ839154
dbEST ID: 79656856
Trimmed Sequence: ATGAAGGCGTCCGGCACTCTAAGGGAGTATAAGGTCATCGGGCGCAGTTTGCCTACTCCCAAAGCTCCTTCTCCACCTCTCTATCGCATGAGAATTTTTGCTCCTAATCATGTGGTTGCCAAGTCCCGCTTTTGGTACTTTGTATCTCAGTTGAAGAAGATGAAGAAGGCATCAGGTGAAATTGTCTATTGTGGACAGGTATTTGAAAAGACCCCTCTGAAGGTGAAGAACTTTGGCATCTGGCTACGCTATGACTCTCGCAGTGGAACACACAACATGTACAGGGAATACAGAGATTTAACCACTGCTGCTGCTGTGACCCAGTGCTACCGTGATATGGGCGCTCGCCACCGTGCTCGTGCCCATGCAATTCAGATCATGAAAGTAGAGGTTATTCCTGCCAGCAAGTGTCGCAGACCTGCTATCAAGCAGTTCCATGACTCAAAGATCAAGTTCCCTCTACCACACAGAGTACTACGTCGCCAGCACAAGCCACGTTTCACCACCAAGAGACCAAACACTTTCTTCTT
Full Trace Sequence: GCTCGCGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGCGTCCGGCACTCTAAGGGAGTATAAGGTCATCGGGCGCAGTTTGCCTACTCCCAAAGCTCCTTCTCCACCTCTCTATCGCATGAGAATTTTTGCTCCTAATCATGTGGTTGCCAAGTCCCGCTTTTGGTACTTTGTATCTCAGTTGAAGAAGATGAAGAAGGCATCAGGTGAAATTGTCTATTGTGGACAGGTATTTGAAAAGACCCCTCTGAAGGTGAAGAACTTTGGCATCTGGCTACGCTATGACTCTCGCAGTGGAACACACAACATGTACAGGGAATACAGAGATTTAACCACTGCTGCTGCTGTGACCCAGTGCTACCGTGATATGGGCGCTCGCCACCGTGCTCGTGCCCATGCAATTCAGATCATGAAAGTAGAGGTTATTCCTGCCAGCAAGTGTCGCAGACCTGCTATCAAGCAGTTCCATGACTCAAAGATCAAGTTCCCTCTACCACACAGAGTACTACGTCGCCAGCACAAGCCACGTTTCACCACCAAGAGACCAAACACTTTCTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTAAATTTAATCGAATTACATGGTCATAGCTGGTTCAAAAAAAAAAAAGACAAATGTCTCAAAACTCCCTAAAGTACAAAAACAGGAAAAAGAGTAGTTCGGTGCGGGTTTGTACAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGCGTCCGGCACTCTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839153
dbEST ID: 79656855
Trimmed Sequence: GAAGAAAGTGTTTGGTCTCTTGGTGGTGAAACGTGGCTTGTGCTGGCGACGTAGTACTCTGTGTGGTAGAGGGAACTTGATCTTTGAGTCATGGAACTGCTTGATAGCAGGTCTGCGACACTTGCTGGCAGGAATAACCTCTACTTTCATGATCTGAATTGCATGGGCACGAGCACGGTGGCGAGCGCCCATATCACGGTAGCACTGGGTCACAGCAGCAGCAGTGGTTAAATCTCTGTATTCCCTGTACATGTTGTGTGTTCCACTGCGAGAGTCATAGCGTAGCCAGATGCCAAAGTTCTTCACCTTCAGAGGGGTCTTTTCAAATACCTGTCCACAATAGACAATTTCACCTGATGCCTTCTTCATCTTCTTCAACTGAGATACAAAGTACCAAAAGCGGGACTTGGCAACCACATGATTAGGAGCAAAAATTCTCATGCGATAGAAAGGTGGAGAAGGAGCTTTGGGAGTACGCAAACTGCGCCCGATGACCTTAGACTCCCTTAAAGTGCCGGACGCCTTCCTGG
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGAAAGTGTTTGGTCTCTTGGTGGTGAAACGTGGCTTGTGCTGGCGACGTAGTACTCTGTGTGGTAGAGGGAACTTGATCTTTGAGTCATGGAACTGCTTGATAGCAGGTCTGCGACACTTGCTGGCAGGAATAACCTCTACTTTCATGATCTGAATTGCATGGGCACGAGCACGGTGGCGAGCGCCCATATCACGGTAGCACTGGGTCACAGCAGCAGCAGTGGTTAAATCTCTGTATTCCCTGTACATGTTGTGTGTTCCACTGCGAGAGTCATAGCGTAGCCAGATGCCAAAGTTCTTCACCTTCAGAGGGGTCTTTTCAAATACCTGTCCACAATAGACAATTTCACCTGATGCCTTCTTCATCTTCTTCAACTGAGATACAAAGTACCAAAAGCGGGACTTGGCAACCACATGATTAGGAGCAAAAATTCTCATGCGATAGAAAGGTGGAGAAGGAGCTTTGGGAGTACGCAAACTGCGCCCGATGACCTTAGACTCCCTTAAAGTGCCGGACGCCTTCCTGGTGCCAACTTTTTTTATACGAAGTTGGCATTATAAAAAAACCATTGGCTCATCAATTTGGTTGCAACAAAACAGGTTAACTATCATTCCAAAAAAAAATCCATTATTTGGGGGCACAAAAACTATAAAACCGGCGCCGTCGTTTTTACCAACGTCTCGGGACAAGGNGAGATTTTCGTGGGGCGCCGCCCGCGGCGCTCGTGTGTCACCAAATCGCAAGTTGAAATTTATAAAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGAAAGTGTTTGGTCTCTTGGT