ORFeome > rpl19 ORF1 – XORFeome v1.0

rpl19 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpl19
Gene ID: 1008920
Gene Page ID: 1008914
ORF Xenbase ID: 17294163

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041546
Original XGC clone length: 594

Human orthology & disease relationships

NCBI Entrez ID: 6143
Ensembl gene IDs: ENSG00000108298
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11013
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ824115
dbEST ID: 79641817
Trimmed Sequence: ATGAGCATGCTCAGACTTCAGAAGAGGCTCGCCTCCAGCGTGCTGCGCTGCGGCAAGAAAAAAGTCTGGCTGGATCCAAATGAGACCAATGAGATTGCCAACGCCAACTCTCGTCAGCAGATCCGGAAACTGGTAAAGGATGGCTTGATTATCCGCAAGCCTGTCACTGTCCATTCCCGTGCCCGCTGCAGGAAGAACACCCTTGCCCGTAGGAAGGGCAGACATATGGGCATTGGTAAGAGAAAGGGTACTGCCAATGCACGTATGCCAGAAAAGCTTTCTTGGATGAGGAGGATGAGGATCTTGCGCCGCTTGCTTCGCCGTTACCGCGAATCCAAGAAGATTGACAGGCACATGTACCACAGCCTGTACCTGAAAGTAAAGGGTAACGTGTTCAAGAACAAGCGTATCCTGATGGAGCACATCCACAAACTGAAGGCCGACAAAGCTCGCAAGAAGCTTCTGGCTGACCAGGCTGAGGCTCGCAGGTCTAAGACAAAGGAGGCAAGGAAGAGGCGCGAGGAGAGACTGCAAGCCAAAAAGGAAGAAATTATCAAAAGCCTTTCTAAGGAGGAAGAGTCTGGAAAGAAATT
Full Trace Sequence: GGGCCCCTATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCATGCTCAGACTTCAGAAGAGGCTCGCCTCCAGCGTGCTGCGCTGCGGCAAGAAAAAAGTCTGGCTGGATCCAAATGAGACCAATGAGATTGCCAACGCCAACTCTCGTCAGCAGATCCGGAAACTGGTAAAGGATGGCTTGATTATCCGCAAGCCTGTCACTGTCCATTCCCGTGCCCGCTGCAGGAAGAACACCCTTGCCCGTAGGAAGGGCAGACATATGGGCATTGGTAAGAGAAAGGGTACTGCCAATGCACGTATGCCAGAAAAGCTTTCTTGGATGAGGAGGATGAGGATCTTGCGCCGCTTGCTTCGCCGTTACCGCGAATCCAAGAAGATTGACAGGCACATGTACCACAGCCTGTACCTGAAAGTAAAGGGTAACGTGTTCAAGAACAAGCGTATCCTGATGGAGCACATCCACAAACTGAAGGCCGACAAAGCTCGCAAGAAGCTTCTGGCTGACCAGGCTGAGGCTCGCAGGTCTAAGACAAAGGAGGCAAGGAAGAGGCGCGAGGAGAGACTGCAAGCCAAAAAGGAAGAAATTATCAAAAGCCTTTCTAAGGAGGAAGAGTCTGGAAAGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCCGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCAATAACTGTTTCCTGGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCATGCTCAGACTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829423
dbEST ID: 79647125
Trimmed Sequence: TTTCTTTCCAGACTCTTCCTCCTTAGAAAGGCTTTTGATAATTTCTTCCTTTTTGGCTTGCAGTCTCTCCTCGCGCCTCTTCCTTGCCTCCTTTGTCTTAGACCTGCGAGCCTCAGCCTGGTCAGCCAGAAGCTTCTTGCGAGCTTTGTCGGCCTTCAGTTTGTGGATGTGCTCCATCAGGATACGCTTGTTCTTGAACACATTACCCTTTACTTTCAGGTACAGGCTGTGGTACATGTGCCTGTCAATCTTCTTGGATTCGCGGTATCTGCGAAGCAAGCGGCGCAAGATGCTCATCCGCCTCACCAAAGAAAGGTTTTCTAGCAGACGAGCATTGGGAGTGCCCTTTCACTTACAATGCCCATATGTAGTACCGACCTAACAGACAAGTGTTGTTCTTCTTGGAGCGGGTACTGTATTGGTGGTGGTAAGGTTGTGGATAATAAGACGATTGTGGTTTGGATTTAGGGATTTGTTGCAGGGAGTGGGAAGGTGGGGAGAACCTATGGAGGTGCATTTGGTGGATGTGATGAGGTGTTGGTTGCGTGACAGTAGCATGTTTGGAGGAAGAACAATTGCTGGAGGTGTGGGGAATGGGGATGTGGGGGGGATGGTGGTGGGGAAAAAATGTGGGGGTGAGATGATAAGGGGTATGTGTGCAGGGAAGATGTTGATAGACGCAAGGTGAGTGTGTGGTTTGAAAAAAAAAAAATAAAAAAAAACAATATATTAAAAGAAGAATGGATGACACGCATAAAATAATTGTGATTAA
Full Trace Sequence: GGACAGCTGCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCNTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTTCCAGACTCTTCCTCCTTAGAAAGGCTTTTGATAATTTCTTCCTTTTTGGCTTGCAGTCTCTCCTCGCGCCTCTTCCTTGCCTCCTTTGTCTTAGACCTGCGAGCCTCAGCCTGGTCAGCCAGAAGCTTCTTGCGAGCTTTGTCGGCCTTCAGTTTGTGGATGTGCTCCATCAGGATACGCTTGTTCTTGAACACATTACCCTTTACTTTCAGGTACAGGCTGTGGTACATGTGCCTGTCAATCTTCTTGGATTCGCGGTATCTGCGAAGCAAGCGGCGCAAGATGCTCATCCGCCTCACCAAAGAAAGGTTTTCTAGCAGACGAGCATTGGGAGTGCCCTTTCACTTACAATGCCCATATGTAGTACCGACCTAACAGACAAGTGTTGTTCTTCTTGGAGCGGGTACTGTATTGGTGGTGGTAAGGTTGTGGATAATAAGACGATTGTGGTTTGGATTTAGGGATTTGTTGCAGGGAGTGGGAAGGTGGGGAGAACCTATGGAGGTGCATTTGGTGGATGTGATGAGGTGTTGGTTGCGTGACAGTAGCATGTTTGGAGGAAGAACAATTGCTGGAGGTGTGGGGAATGGGGATGTGGGGGGGATGGTGGTGGGGAAAAAATGTGGGGGTGAGATGATAAGGGGTATGTGTGCAGGGAAGATGTTGATAGACGCAAGGTGAGTGTGTGGTTTGAAAAAAAAAAAATAAAAAAAAACAATATATTAAAAGAAGAATGGATGACACGCATAAAATAATTGTGATTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTTCCAGACTCTTCCTCCTT