ORFeome > rpl21 ORF1 – XORFeome v1.0

rpl21 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl21
Gene ID: 979614
Gene Page ID: 979607
ORF Xenbase ID: 17294175

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053767
Original XGC clone length: 483

Human orthology & disease relationships

NCBI Entrez ID: 6144
Ensembl gene IDs: ENSG00000122026
Directly associated (OMIM) disease MIM numbers: 615885
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11001
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ839098
dbEST ID: 79656800
Trimmed Sequence: ATGACCAACACAAGAGGAAAAAGGCGAGGAACTCGTTATATGTTCTCCAGACCCTTCCGCAAGCATGGTGCCGTACCTCTGTCAACTTACATGCGCATCTACAAGAAGGGTGATATTGTGGACATAAAGGGTATGGGCACAATCCAAAAAGGTATGCCCCACAAATGTTACCACGGCAAGACTGGCAGAGTTTACAATGTTACACAGCACGCTGTAGGAATTATTGTGAACAAGCAGCTCAGGGGCCGTATCCTTGCCAAGAGAATCAATGTCCGCGTTGAGCACATTCGTCACTCTAAGAGCAGAGACAGTTTCCTCCAGCGCGTGAAAGAGAATGAGAGGAAGAAGAAAGAGGCCAAGGAAAAGGGATTATGGGTCGAACTGAAACGCCAGCCTGCCCAGCCCAGAGAAGCTCACTTTGTTCGGACTGGTGGTGTCGAGCCACAGCTGCTTGAGCCTATTCCATACGAGTTCATGGCATT
Full Trace Sequence: GCTCGAGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCAACACAAGAGGAAAAAGGCGAGGAACTCGTTATATGTTCTCCAGACCCTTCCGCAAGCATGGTGCCGTACCTCTGTCAACTTACATGCGCATCTACAAGAAGGGTGATATTGTGGACATAAAGGGTATGGGCACAATCCAAAAAGGTATGCCCCACAAATGTTACCACGGCAAGACTGGCAGAGTTTACAATGTTACACAGCACGCTGTAGGAATTATTGTGAACAAGCAGCTCAGGGGCCGTATCCTTGCCAAGAGAATCAATGTCCGCGTTGAGCACATTCGTCACTCTAAGAGCAGAGACAGTTTCCTCCAGCGCGTGAAAGAGAATGAGAGGAAGAAGAAAGAGGCCAAGGAAAAGGGATTATGGGTCGAACTGAAACGCCAGCCTGCCCAGCCCAGAGAAGCTCACTTTGTTCGGACTGGTGGTGTCGAGCCACAGCTGCTTGAGCCTATTCCATACGAGTTCATGGCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTAATGGTCATAGCTGTTTAATGGCAGCACTGGCCGTGTCTCAATCCCTTGGAATGTACACNNNNNNNNGNNGNNNGGNNNNNGNGGGGNGNGNGGGGGGGGNGGNCCCNCTTNGGGGGTGTGGGGGGGGGCCCCCCCGCGCGTAAAAAAAAAACAAAAAAAAAAAAAATAAAAAAAAAAAAAAAAAAAAAAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCAACACAAGAGGAAAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839097
dbEST ID: 79656799
Trimmed Sequence: TGCCATGAACTCGTATGGAATAGGCTCAAGCAGCTGTGGCTCGACACCACCAGTCCGAACAAAGTGAGCTTCTCTGGGCTGGGCAGGCTGGCGTTTCAGTTCGACCCATAATCCCTTTTCCTTGGCCTCTTTCTTCTTCCTCTCATTCTCTTTCACGCGCTGGAGGAAACTGTCTCTGCTCTTAGAGTGACGAATGTGCTCAACGCGGACATTGATTCTCTTGGCAAGGATACGGCCCCTGAGCTGCTTGTTCACAATAATTCCTACAGCGTGCTGTGTAACATTGTAAACTCTGCCAGTCTTGCCGTGGTAACATTTGTGGGGCATACCTTTTTGGATTGTGCCCATACCCTTTATGTCCACAATATCACCCTTCTTGTGCATGCGCATGTAACTTGACAGAGGTACGGCACCCTGCCTGCGGAAGGGTCTGGAGAACATATAACGATTTCTTCGCCTTTTTCCTCTTGTGTTGGCATGG
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAATGCCATGAACTCGTATGGAATAGGCTCAAGCAGCTGTGGCTCGACACCACCAGTCCGAACAAAGTGAGCTTCTCTGGGCTGGGCAGGCTGGCGTTTCAGTTCGACCCATAATCCCTTTTCCTTGGCCTCTTTCTTCTTCCTCTCATTCTCTTTCACGCGCTGGAGGAAACTGTCTCTGCTCTTAGAGTGACGAATGTGCTCAACGCGGACATTGATTCTCTTGGCAAGGATACGGCCCCTGAGCTGCTTGTTCACAATAATTCCTACAGCGTGCTGTGTAACATTGTAAACTCTGCCAGTCTTGCCGTGGTAACATTTGTGGGGCATACCTTTTTGGATTGTGCCCATACCCTTTATGTCCACAATATCACCCTTCTTGTGCATGCGCATGTAACTTGACAGAGGTACGGCACCCTGCCTGCGGAAGGGTCTGGAGAACATATAACGATTTCTTCGCCTTTTTCCTCTTGTGTTGGCATGGTGCCAACTTTTTTGTAAAAATTGGCATAATAAAAAGCATTGCTCAACAATTTGTTGACACGAACAGGTCACAATCAGTCAAAATAAAACTCATTATTTGGGGCCCAAATATAAAAATGGCCCGTCGTTTTACCACACCGAGAACTGGGCATTNNNCNGGAAGGTTTGGGNCAGATGTCTCAATTTCTTGNNTTTTAAAAANNNNTTANNNGNTCGCANNTAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAATTAAAATNAAATNAAACTGNANAAAATNACGTTAGAAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCATGAACTCGTATGGAA