ORFeome > rpl22 ORF1 – XORFeome v1.0

rpl22 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpl22
Gene ID: 978445
Gene Page ID: 978438
ORF Xenbase ID: 17294181

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC091778
Original XGC clone length: 387

Human orthology & disease relationships

NCBI Entrez ID: 6146
Ensembl gene IDs: ENSG00000116251
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11073
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ835556
dbEST ID: 79653258
Trimmed Sequence: ATGGCTCCTGTGAAGAAGACCGTAACCAAGGGCAGCAAGAAAAAGAAGCAGCTGCTCAAATTCACCTTGGATTGTACTCATCCAGTGGAAGATGGCATCATGGATGCTGCTAATTTTGAGCAGTTTTTGCACGACCGTATCAAAGTAAACGGCAAGGTTGGAAACTTGGGAGGAGGAGTAGTCTCTATTGAACGAAGCAAGAGTAAAATCACTGTGTCTTCAGAAGTTCCATTTTCAAAGAGGTATCTAAAGTACCTCACTAAGAAATATCTGAAGAAAAACAACCTCCGTGATTGGCTTCGTGTGGTTGCAAATAGCAAGGAAAGCTACGAACTAAGATACTTCCAGATTAACCAGGATGAAGAGGAAGAAGAGGATGAAGATTT
Full Trace Sequence: GGGCGTCGTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTGTGAAGAAGACCGTAACCAAGGGCAGCAAGAAAAAGAAGCAGCTGCTCAAATTCACCTTGGATTGTACTCATCCAGTGGAAGATGGCATCATGGATGCTGCTAATTTTGAGCAGTTTTTGCACGACCGTATCAAAGTAAACGGCAAGGTTGGAAACTTGGGAGGAGGAGTAGTCTCTATTGAACGAAGCAAGAGTAAAATCACTGTGTCTTCAGAAGTTCCATTTTCAAAGAGGTATCTAAAGTACCTCACTAAGAAATATCTGAAGAAAAACAACCTCCGTGATTGGCTTCGTGTGGTTGCAAATAGCAAGGAAAGCTACGAACTAAGATACTTCCAGATTAACCAGGATGAAGAGGAAGAAGAGGATGAAGATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACTTGGTCATAGCTGTTTCCTAGCAGCACTGGCCCGTGTCTCAACTAATAAAGATTTATAACAAGGCGGGAGATTGAATTATTATCTGCTTCTTCCCACGAATGCCGGGTGAGGTTAACAGGGGGCTCGAAGAAAAGAAAAACCCGAGAAGGAAAAATGGAACGGGCCCCAATTGAACACGAGAAGAGGCCGCGAACAGGGGGGGGAGCCCGACCCTTGTTCCGGCACCCGCGTGTGGGAAAGCGGGGGGGTGGGGTTTTGGGGGCTTCTTATAAATTGTTTTTTTTTGGGACAAAAATAAAATATAACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTGTGAAGAAGACCGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ835557
dbEST ID: 79653259
Trimmed Sequence: ATCTTCATCCTCTTCTTCCTCTTCATCCTGGTTAATCTGGAAGTATCTTAGTTCGTAGCTTTCCTTGCTATTTGCAACCACACGAAGCCAATCACGGAGGTTGTTTTTCTTCAGATATTTCTTAGTGAGGTACTTTAGATACCTCTTTGAAAATGGAACTTCTGAAGACACAGTGATTTTACTCTTGCTTCGTTCAATAGAGACTACTCCTCCTCCCAAGTTTCCAACCTTGCCGTTTACTTTGATACGGTCGTGCAAAAACTGCTCAAAATTAGCAGCATCCATGATGCCATCTTCCACTGGATGAGTACAATCCAAGGTGAATTTGAGCAGCTGCTTCTTTTTCTTGCTGCCCTTGGTTACGGTCTTCTTCACAGGAGCCATGG
Full Trace Sequence: CGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCTTCATCCTCTTCTTCCTCTTCATCCTGGTTAATCTGGAAGTATCTTAGTTCGTAGCTTTCCTTGCTATTTGCAACCACACGAAGCCAATCACGGAGGTTGTTTTTCTTCAGATATTTCTTAGTGAGGTACTTTAGATACCTCTTTGAAAATGGAACTTCTGAAGACACAGTGATTTTACTCTTGCTTCGTTCAATAGAGACTACTCCTCCTCCCAAGTTTCCAACCTTGCCGTTTACTTTGATACGGTCGTGCAAAAACTGCTCAAAATTAGCAGCATCCATGATGCCATCTTCCACTGGATGAGTACAATCCAAGGTGAATTTGAGCAGCTGCTTCTTTTTCTTGCTGCCCTTGGTTACGGTCTTCTTCACAGGAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAACAGGCCGTCGTTTTACAACTCAGCTGACATGGGAACTTCGATGTTGCCTACAGACAATTGTCACTTATCCGAAGGTTGACCCATAAAAATAAATAGATTTGCGTCGGTGCGCTTCTCTCCGAAAGAAAAGCAAAATACTGGGACGCAAAGTGTAAAATAAGAAAAAATAAGGGGGTCCTCTGCCGGCCCCCGCAACCCCCGATCTCCTCTCTTTTTTTATAAAAATTTTGGGCCGGGAGGGGGAAAACACCCTCCCCCTTTTTTGGTTTTGAAATTAAAAAACAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTTCATCCTCTTCTTCCTC