ORFeome > rpl22l1 ORF1 – XORFeome v1.0

rpl22l1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpl22l1
Gene ID: 6073199
Gene Page ID: 6073102
ORF Xenbase ID: 17294187

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC128978
Original XGC clone length: 372

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ837627
dbEST ID: 79655329
Trimmed Sequence: ATGGCGCTGACAAAGCAGACCAAAGACAAGAAGCTAAAGAGGGCCTGGAACTTCACCCTGGATTTGACACATCCAGTGGAAGATGGTATCTTTGATTCTGTCAACTTTGAACAGTTTCTGAAAGAGAAAATTAAGGTTAATGGAAAAACCGGAAACCTCGGAAACATTGTTCATATTGGACGTTTGAAAAGCAAGATTACGGTTTCATCTGAGAAAAGTTTTTCTAAAAGGTACCTAAAATACCTGACAAAGAAATATCTCAAGAAAAACAACTTGCGTGACTGGCTGCGGGTAGTTGCATCTGACAAAGCAACCTATGAGCTCAGATACTTCCAGATCAGCCAGGATGATGAATCAGAATCTGAAGAATT
Full Trace Sequence: GGCGTGTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGACAAAGCAGACCAAAGACAAGAAGCTAAAGAGGGCCTGGAACTTCACCCTGGATTTGACACATCCAGTGGAAGATGGTATCTTTGATTCTGTCAACTTTGAACAGTTTCTGAAAGAGAAAATTAAGGTTAATGGAAAAACCGGAAACCTCGGAAACATTGTTCATATTGGACGTTTGAAAAGCAAGATTACGGTTTCATCTGAGAAAAGTTTTTCTAAAAGGTACCTAAAATACCTGACAAAGAAATATCTCAAGAAAAACAACTTGCGTGACTGGCTGCGGGTAGTTGCATCTGACAAAGCAACCTATGAGCTCAGATACTTCCAGATCAGCCAGGATGATGAATCAGAATCTGAAGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTAAAAGAAGTCTCAAAATCTCAGAATGTGGCATTCTCGGGGGCGCGGCGCGGGTGGGAGGGAAACGACCGGCCCCTAAAAAAAGCGGGGGGAGTGAGTTTACCCGTTTTCTTTGGTGATAACTAACCCAAGGGAACAAAAAACCCCCGGCACGTTATTTTTAAATTAGGAAGGGAGGGGCGCCACGACCCCGCGGCCGGCCAAAAAAATTAAAAAAAAAAAAGAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGACAAAGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837626
dbEST ID: 79655328
Trimmed Sequence: TTCTTCAGATTCTGATTCATCATCCTGGCTGATCTGGAAGTATCTGAGCTCATAGGTTGCTTTGTCAGATGCAACTACCCGCAGCCAGTCACGCAAGTTGTTTTTCTTGAGATATTTCTTTGTCAGGTATTTTAGGTACCTTTTAGAAAAACTTTTCTCAGATGAAACCGTAATCTTGCTTTTCAAACGTCCAATATGAACAATGTTTCCGAGGTTTCCGGTTTTTCCATTAACCTTAATTTTCTCTTTCAGAAACTGTTCAAAGTTGACAGAATCAAAGATACCATCTTCCACTGGATGTGTCAAATCCAGGGTGAAGTTCCAGGCCCTCTTTAGCTTCTTGTCTTTGGTCTGCTTTGTCAGCGCCATGG
Full Trace Sequence: CGGGAAACTGCTACTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTTCAGATTCTGATTCATCATCCTGGCTGATCTGGAAGTATCTGAGCTCATAGGTTGCTTTGTCAGATGCAACTACCCGCAGCCAGTCACGCAAGTTGTTTTTCTTGAGATATTTCTTTGTCAGGTATTTTAGGTACCTTTTAGAAAAACTTTTCTCAGATGAAACCGTAATCTTGCTTTTCAAACGTCCAATATGAACAATGTTTCCGAGGTTTCCGGTTTTTCCATTAACCTTAATTTTCTCTTTCAGAAACTGTTCAAAGTTGACAGAATCAAAGATACCATCTTCCACTGGATGTGTCAAATCCAGGGTGAAGTTCCAGGCCCTCTTTAGCTTCTTGTCTTTGGTCTGCTTTGTCAGCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAGAATAAAATCATTATTTGGGGCCCGAGCTAAAGACAAGACGTCAATTTACATTATCCTGAACTGGGGAAGTCGCGGGGCTAATGGACACAAATGGGCGATCCAAAAAAAGAGAAGAAGAACTATTGTGTATGTTGGGGGGGGCGTGGAGAGGGGGCGACAGGCAGGCGGTTATAATAAAAAAGGGGGAGCCTGGGGGGGGGGGGGGGGCGGTCCCATTTTTTTTTATACGGTGGGGGGTGGGGGGGCGGGCCGGGTTTGTCTGTGTGGGAGAAGAGTTTGTTTTGTTGTCGAGGGGATTAAAAGTGAGAGTGTAAGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTTCAGATTCTGATTCATCATC