ORFeome > rpl23a ORF1 – XORFeome v1.0

rpl23a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl23a
Gene ID: 5891407
Gene Page ID: 5891037
ORF Xenbase ID: 17294199

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078526
Original XGC clone length: 468

Human orthology & disease relationships

NCBI Entrez ID: 6147
Ensembl gene IDs: ENSG00000198242
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,104300,105120,108120,115200,123500,125853,131950,145980,151660,159001,176670,181350,182290,184500,211980,215600,226650,226670,245050,248370,600652,603278,603896,604219,604929,605588,606054,606595,607841,607920,608056,609015,609285

Library Location

Plate ID: GDExl11005
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ839800
dbEST ID: 79657502
Trimmed Sequence: ATGGCTCCTAAAGCGAAGAAGGAAGCTGTCCCTCCAAAGACTGAGGCGAAGTCTAAGGCTCTCAAGGCCAAAAAGGCTGTTTTGAAAGGAGTCCACAGTCACAAGAAAAAGAAAATCAGGACCTCACCAACTTTCAGGAGGCCGAAGACATTGAGACTGAGGAGGCAACCCAAGTATCCTAGAAAGAGCGCCCCCACAAGGAACAAGCTTGATCATTATGCTATTATCAAGTTCCCACTGACCACTGAGTCGGCCATGAAGAAGATTGAAGACAACAACACTCTGGTTTTCATAGTTGATGTCAAAGCAAACAAGCACCAGATCAAGCAGGCAGTGAAGCAACTCTATGACATTGACGTACAAAAAGTGAACACCTTGATCAGGCCTGATGGTGAAAAGAAAGCATATGTCCGCCTGGCTCCCGATTATGATGCCTTGGATGTTGCAAATAAGATTGGCATCATCTT
Full Trace Sequence: GCTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTAAAGCGAAGAAGGAAGCTGTCCCTCCAAAGACTGAGGCGAAGTCTAAGGCTCTCAAGGCCAAAAAGGCTGTTTTGAAAGGAGTCCACAGTCACAAGAAAAAGAAAATCAGGACCTCACCAACTTTCAGGAGGCCGAAGACATTGAGACTGAGGAGGCAACCCAAGTATCCTAGAAAGAGCGCCCCCACAAGGAACAAGCTTGATCATTATGCTATTATCAAGTTCCCACTGACCACTGAGTCGGCCATGAAGAAGATTGAAGACAACAACACTCTGGTTTTCATAGTTGATGTCAAAGCAAACAAGCACCAGATCAAGCAGGCAGTGAAGCAACTCTATGACATTGACGTACAAAAAGTGAACACCTTGATCAGGCCTGATGGTGAAAAGAAAGCATATGTCCGCCTGGCTCCCGATTATGATGCCTTGGATGTTGCAAATAAGATTGGCATCATCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATATTGAGTCGTATTACATGGTCCTATAGAAAAAAATGACAACATAAAACCATGTCTCAATCCTTCTCAAAATTAAAAAAAAAAAAAGGTTTAAATAACAAATGGCCCTGTTGGGGCGGGGGCCCCCCTCTTTAACCGTTGTATCCCCGAACCCCCAACAAAAAAAAAAAAAAAATCCATAGAAAAAAAAAATAACTTTTTGCCCCCCCCCCCCCCCCCCACCACACAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTAAAGCGAAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839799
dbEST ID: 79657501
Trimmed Sequence: GATGATGCCAATCTTATTTGCAACATCCAAGGCATCATAATCGGGAGCCAGGCGGACATATGCTTTCTTTTCACCATCAGGCCTGATCAAGGTGTTCACTTTTTGTACGTCAATGTCATAGAGTTGCTTCACTGCCTGCTTGATCTGGTGCTTGTTTGCTTTGACATCAACTATGAAAACCAGAGTGTTGTTGTCTTCAATCTTCTTCATGGCCGACTCAGTGGTCAGTGGGAACTTGATAATAGCATAATGATCAAGCTTGTTCCTTGTGGGGGCGCTCTTTCTAGGATACTTGGGTTGCCTCCTCAGTCTCAATGTCTTCGGCCTCCTGAAAGTTGGTGAGGTCCTGATTTTCTTTTTCTTGTGACTGTGGACTCCTTTCAAAACAGCCTTTTTGGCCTTGAGAGCCTTAGACTTAGCCTCAGTCTTTGGAGGGACAGCTTCCTTCTTCGCTTTAGGAGCCATGG
Full Trace Sequence: GTGTAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGATGCCAATCTTATTTGCAACATCCAAGGCATCATAATCGGGAGCCAGGCGGACATATGCTTTCTTTTCACCATCAGGCCTGATCAAGGTGTTCACTTTTTGTACGTCAATGTCATAGAGTTGCTTCACTGCCTGCTTGATCTGGTGCTTGTTTGCTTTGACATCAACTATGAAAACCAGAGTGTTGTTGTCTTCAATCTTCTTCATGGCCGACTCAGTGGTCAGTGGGAACTTGATAATAGCATAATGATCAAGCTTGTTCCTTGTGGGGGCGCTCTTTCTAGGATACTTGGGTTGCCTCCTCAGTCTCAATGTCTTCGGCCTCCTGAAAGTTGGTGAGGTCCTGATTTTCTTTTTCTTGTGACTGTGGACTCCTTTCAAAACAGCCTTTTTGGCCTTGAGAGCCTTAGACTTAGCCTCAGTCTTTGGAGGGACAGCTTCCTTCTTCGCTTTAGGAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGAGGACAAAGCATAATACTGGCCGTCGTTTACATCGACTTTTGAATGGGCTCATTCCAACAGAACGCCAGGGCGAAGGGGGGCCTTCCTTTGATCGGGTATTTTCCGATACCCGTCCCCATACTCGGTAGATTCCACAGGGTAAAAGAATAAAAATGAACAAACATCCCCGGTGGCGGAACTTCCACACACCGCAGGGGAAGACCGCCAGGGGTGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGATGCCAATCTTATTTGCAAC