ORFeome > rpl24 ORF1 – XORFeome v1.0

rpl24 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl24
Gene ID: 963927
Gene Page ID: 963921
ORF Xenbase ID: 17294205

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078474
Original XGC clone length: 420

Human orthology & disease relationships

NCBI Entrez ID: 6152
Ensembl gene IDs: ENSG00000114391
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 182290,215600,603896,607841

Library Location

Plate ID: GDExl11005
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ839816
dbEST ID: 79657518
Trimmed Sequence: ATGAAGGTCGAGCTGTGCAGCTTCAGTGGCTACAAGATCTACCCGGGGCACGGGCGGCGCTACGCCAGGACTGATGGAAAGGTTTTCCAATTCCTGAATGCAAAATGCGAGTCCGCTTTCCTTTCAAAGAGGAACCCTCGTCAGATCAATTGGACTGTTCTGTACAGACGGAAACACAAGAAGGGGCAGTCAGAAGAAATTCAGAAGAAACGTACTCGCCGCGCAGTGAAATTCCAGAGGGCTATCACTGGTGCCTCTCTGGCTGAAATTATGGCCAAGAGAAATCAGAAGCCCGAAGTACGAAAGGCTCAACGAGAACAGGCAATTAGAGCTGCCAAGGAAGTAAAGAAGGCTAAACAGGCAACCAAAAAGGCTGCTCCTGCAAAGGCTCCATCAAGTCTGCACCTAAGCAGAAAATT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGTCGAGCTGTGCAGCTTCAGTGGCTACAAGATCTACCCGGGGCACGGGCGGCGCTACGCCAGGACTGATGGAAAGGTTTTCCAATTCCTGAATGCAAAATGCGAGTCCGCTTTCCTTTCAAAGAGGAACCCTCGTCAGATCAATTGGACTGTTCTGTACAGACGGAAACACAAGAAGGGGCAGTCAGAAGAAATTCAGAAGAAACGTACTCGCCGCGCAGTGAAATTCCAGAGGGCTATCACTGGTGCCTCTCTGGCTGAAATTATGGCCAAGAGAAATCAGAAGCCCGAAGTACGAAAGGCTCAACGAGAACAGGCAATTAGAGCTGCCAAGGAAGTAAAGAAGGCTAAACAGGCAACCAAAAAGGCTGCTCCTGCAAAGGCTCCATCAAGTCTGCACCTAAGCAGAAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCAAAAAAAAAAAAAAAAAAAAAAAAAAATACATTTTTTCCCCGTGAGACGGGGAGGGGGGGGGCTCCCCCCTCCCCCCCCCCAAAAAAAAAAAGAAAGGGCCATAAGTAAATAAGTGTGTGGGGACCCGCCTCCTCCAAAACCAACAGGGCGGGGGGTTGAGGTTGCTGTGTATTTTTCGGGCGCGCCCGCCGGGGGGGGGGGGGGGGAGAACACCACAAAGGGAGGGGGGGGGGAGAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGTCGAGCTGTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839815
dbEST ID: 79657517
Trimmed Sequence: TTTTCTGCTTAGGTGCAGACTTGATGGAGCCTTTGCAGGAGCAGCCTTTTTGGTTGCCTGTTTAGCCTTCTTTACTTCCTTGGCAGCTCTAATTGCCTGTTCTCGTTGAGCCTTTCGTACTTCGGGCTTCTGATTTCTCTTGGCCATAATTTCAGCCAGAGAGGCACCAGTGATAGCCCTCTGGAATTTCACTGCGCGGCGAGTACGTTTCTTCTGAATTTCTTCTGACTGCCCCTTCTTGTGTTTCCGTCTGTACAGAACAGTCCAATTGATCTGACGAGGGTTCCTCTTTGAAAGGAAAGCGGACTCGCATTTTGCATTCAGGAATTGGAAAACCTTTCCATCAGTCCTGGCGTAGCGCCGCCCGTGCCCCGGGTAGATCTTGTAGCCACTGAAGCTGCACAGCTCGACCTTCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTCTGCTTAGGTGCAGACTTGATGGAGCCTTTGCAGGAGCAGCCTTTTTGGTTGCCTGTTTAGCCTTCTTTACTTCCTTGGCAGCTCTAATTGCCTGTTCTCGTTGAGCCTTTCGTACTTCGGGCTTCTGATTTCTCTTGGCCATAATTTCAGCCAGAGAGGCACCAGTGATAGCCCTCTGGAATTTCACTGCGCGGCGAGTACGTTTCTTCTGAATTTCTTCTGACTGCCCCTTCTTGTGTTTCCGTCTGTACAGAACAGTCCAATTGATCTGACGAGGGTTCCTCTTTGAAAGGAAAGCGGACTCGCATTTTGCATTCAGGAATTGGAAAACCTTTCCATCAGTCCTGGCGTAGCGCCGCCCGTGCCCCGGGTAGATCTTGTAGCCACTGAAGCTGCACAGCTCGACCTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTAAAAAAAAAAAATAAAAACAGAAAATACATTACACGTCCTCTCTCCTGGGGGGGGGGGGGGGGGAGATACCACCTCTCTGTCGCCCGGGGGGGGGGGGGGTCTTTGTTTGTGGGGTGGGGGGGGCCCCCCCCCGCGAGAAAAAAGCGCGCGGGGGGGAAGGTAGAAAAATAGACCCCCCCCCCCGCCGGGTCCCACGCCCACCCAGCGCGCTGTGTGGTGGTGTGTTTGTTTGTTTTTTTTTTTATTTTATTTTATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTCTGCTTAGGTGCAGACTT