ORFeome > rpl27a ORF1 – XORFeome v1.0

rpl27a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl27a
Gene ID: 5853953
Gene Page ID: 5853518
ORF Xenbase ID: 17294223

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053769
Original XGC clone length: 447

Human orthology & disease relationships

NCBI Entrez ID: 6157
Ensembl gene IDs: ENSG00000166441
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11001
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ839078
dbEST ID: 79656780
Trimmed Sequence: ATGCCATCCAAACTGAGAAAGACCAGGAAGCTACGTGGGCACGTCAGTCACGGCCATGGCCGAATTGGCAAACACAGGAAGCACCCTGGTGGTCGTGGTAATGCTGGTGGTATGCATCACCACAGAATCAACTTTGATAAATACCACCCTGGATATTTTGGAAAAGTTGGTATGAGACATTACCATCTGAAAAAAAATCAGTCTTTCTGTCCTACTATCAACTTGGATAAACTGTGGACACTTGTCAGTGAGCAGACAAGGCTGAACCATGCAAAGAACCTTGAAGGCCCAGCACCAATCATCGATGCTGTTCATGCTGGTTATTACAAGGTATTGGGAAAAGGCAAGCTCCCTAAGCAGCCAGTGATTGTGAAAGCAAAATTCTTCAGCAGGAAAGCAGAGGAGAAAATTAAGAGTGTTGGTGGTGCTTGTGTGCTAGTTGCATT
Full Trace Sequence: GAAGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCATCCAAACTGAGAAAGACCAGGAAGCTACGTGGGCACGTCAGTCACGGCCATGGCCGAATTGGCAAACACAGGAAGCACCCTGGTGGTCGTGGTAATGCTGGTGGTATGCATCACCACAGAATCAACTTTGATAAATACCACCCTGGATATTTTGGAAAAGTTGGTATGAGACATTACCATCTGAAAAAAAATCAGTCTTTCTGTCCTACTATCAACTTGGATAAACTGTGGACACTTGTCAGTGAGCAGACAAGGCTGAACCATGCAAAGAACCTTGAAGGCCCAGCACCAATCATCGATGCTGTTCATGCTGGTTATTACAAGGTATTGGGAAAAGGCAAGCTCCCTAAGCAGCCAGTGATTGTGAAAGCAAAATTCTTCAGCAGGAAAGCAGAGGAGAAAATTAAGAGTGTTGGTGGTGCTTGTGTGCTAGTTGCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGGTCATAGCTGTTTCCTGAAAAAAAAAGAACAGTGTCTCAAAAACTCTTAATGTTACAANNNNNNNNGNNNNNNNGNNGNGNNGGNGGGNGCGNNNCCCCNNGGGGGGGGGGGGGGGTATGGCTGGTNNTGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCATCCAAACTGAGAAAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839077
dbEST ID: 79656779
Trimmed Sequence: TGCAACTAGCACACAAGCACCACCAACACTCTTAATTTTCTCCTCTGCTTTCCTGCTGAAGAATTTTGCTTTCACAATCACTGGCTGCTTAGGGAGCTTGCCTTTTCCCAATACCTTGTAATAACCAGCATGAACAGCATCGATGATTGGTGCTGGGCCTTCAAGGTTCTTTGCATGGTTCAGCCTTGTCTGCTCACTGACAAGTGTCCACAGTTTATCCAAGTTGATAGTAGGACAGAAAGACTGATTTTTTTTCAGATGGTAATGTCTCATACCAACTTTTCCAAAATATCCAGGGTGGTATTTATCAAAGTTGATTCTGTGGTGATGCATACCACCAGCATTACCACGACCACCAGGGTGCTTCCTGTGTTTGCCAATTCGGCCATGGCCGTGACTGACGTGCCCACGTAGCTTCCTGGTCTTTCTCAGTTTGGATGGCATGG
Full Trace Sequence: GCGGAAAATGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCAACTAGCACACAAGCACCACCAACACTCTTAATTTTCTCCTCTGCTTTCCTGCTGAAGAATTTTGCTTTCACAATCACTGGCTGCTTAGGGAGCTTGCCTTTTCCCAATACCTTGTAATAACCAGCATGAACAGCATCGATGATTGGTGCTGGGCCTTCAAGGTTCTTTGCATGGTTCAGCCTTGTCTGCTCACTGACAAGTGTCCACAGTTTATCCAAGTTGATAGTAGGACAGAAAGACTGATTTTTTTTCAGATGGTAATGTCTCATACCAACTTTTCCAAAATATCCAGGGTGGTATTTATCAAAGTTGATTCTGTGGTGATGCATACCACCAGCATTACCACGACCACCAGGGTGCTTCCTGTGTTTGCCAATTCGGCCATGGCCGTGACTGACGTGCCCACGTAGCTTCCTGGTCTTTCTCAGTTTGGATGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCAGAACAAAGAAGAGGAAATCGTTTTACACGCCCGGGGACGGGGGGGGTGGGGGCAAAAATAAAAAAAAATTTGGGAGCGGGGGTGGGGCGATGGGTTCGCCGGGGGGGAGGGGAGAGACGCCCCCCCCACGAGGAAAAAAAACAAATAGATGTGTATGTTATTTTGGGAATGAAGACGCAGCGAAAGAAAAAGAGGCAGNNAATCCGAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAACTAGCACACAAGCAC