ORFeome > rpl28 ORF1 – XORFeome v1.0

rpl28 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl28
Gene ID: 6255818
Gene Page ID: 1016752
ORF Xenbase ID: 17294229

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053798
Original XGC clone length: 414

Human orthology & disease relationships

NCBI Entrez ID: 6158
Ensembl gene IDs: ENSG00000108107
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 172700,233700,233710,260540,306400,600274,601104,603896,607485

Library Location

Plate ID: GDExl11002
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ839317
dbEST ID: 79657019
Trimmed Sequence: ATGTCTGCTCACTTGCAATGGATGATTGTTCGTAACTGCTCCAGCTTTATTGTAAAAAGAAACCATCAGGTCTTTAGTACGGAGCCAAACAATCTAAAGGCAAGAAACTCCTTTCGCTACAATGGTCCGATCCACAAGAAAACAGTCGGTGTTGAGCCTGCAGCTGATGGAAAGGGAGTCATTGTTGTGATGAAAAAACGTGCAGGTCAGCGCAAACCTGCAACCTCTTATGAAAAAATCACCATAAACAAGAACTCACGCTCCACTCTGAGCAGCGTGCGTCACATTATCCGCAAGAACAACTACAGGAAGGATCTCCGCATGGCTGCTCTTCGTCGTGCTAGCGCCATCCTGAAGAGCCAGAAACCAGTTGTGGTGAAGAAGAAGCGCTCCCGGGCTGCCAAGACTGCATT
Full Trace Sequence: GCTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGCTCACTTGCAATGGATGATTGTTCGTAACTGCTCCAGCTTTATTGTAAAAAGAAACCATCAGGTCTTTAGTACGGAGCCAAACAATCTAAAGGCAAGAAACTCCTTTCGCTACAATGGTCCGATCCACAAGAAAACAGTCGGTGTTGAGCCTGCAGCTGATGGAAAGGGAGTCATTGTTGTGATGAAAAAACGTGCAGGTCAGCGCAAACCTGCAACCTCTTATGAAAAAATCACCATAAACAAGAACTCACGCTCCACTCTGAGCAGCGTGCGTCACATTATCCGCAAGAACAACTACAGGAAGGATCTCCGCATGGCTGCTCTTCGTCGTGCTAGCGCCATCCTGAAGAGCCAGAAACCAGTTGTGGTGAAGAAGAAGCGCTCCCGGGCTGCCAAGACTGCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTAAAAAAAAAAAAAAAAAATCAATAATATAACAAACAAAAAAAAAAACGGGGGGAAAAAACTCCCCCCTCCTCTTCCCCAAAAAAAAAAAGAAAACCACCTCTTATATAATTGAAAAAGGCGCCCCTTCCGGAAAAACACGTGCGAGGGGGGGATAGTGTGCTGTGATTGATAGGTCGCGGAAGCGGGGGGGGGGGAAGAAAAATAAGACAACACAAAGGAGGAGGAAAAAAGGGGGGGGGAGGGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGCTCACTTGCAATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839316
dbEST ID: 79657018
Trimmed Sequence: TGCAGTCTTGGCAGCCCGGGAGCGCTTCTTCTTCACCACAACTGGTTTCTGGCTCTTCAGGATGGCGCTAGCACGACGAAGAGCAGCCATGCGGAGATCCTTCCTGTAGTTGTTCTTGCGGATAATGTGACGCACGCTGCTCAGAGTGGAGCGTGAGTTCTTGTTTATGGTGATTTTTTCATAAGAGGTTGCAGGTTTGCGCTGACCTGCACGTTTTTTCATCACAACAATGACTCCCTTTCCATCAGCTGCAGGCTCAACACCGACTGTTTTCTTGTGGATCGGACCATTGTAGCGAAAGGAGTTTCTTGCCTTTAGATTGTTTGGCTCCGTACTAAAGACCTGATGGTTTCTTTTTACAATAAAGCTGGAGCAGTTACGAACAATCATCCATTGCAAGTGAGCAGACATGG
Full Trace Sequence: GAGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCAGTCTTGGCAGCCCGGGAGCGCTTCTTCTTCACCACAACTGGTTTCTGGCTCTTCAGGATGGCGCTAGCACGACGAAGAGCAGCCATGCGGAGATCCTTCCTGTAGTTGTTCTTGCGGATAATGTGACGCACGCTGCTCAGAGTGGAGCGTGAGTTCTTGTTTATGGTGATTTTTTCATAAGAGGTTGCAGGTTTGCGCTGACCTGCACGTTTTTTCATCACAACAATGACTCCCTTTCCATCAGCTGCAGGCTCAACACCGACTGTTTTCTTGTGGATCGGACCATTGTAGCGAAAGGAGTTTCTTGCCTTTAGATTGTTTGGCTCCGTACTAAAGACCTGATGGTTTCTTTTTACAATAAAGCTGGAGCAGTTACGAACAATCATCCATTGCAAGTGAGCAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGATCAGAGCTAAAAACAAAAAAACGAATTAAAACACCTTGAACAGGCTTTTTCTGGGCGCTCCTGGCCGTGTCTCAAAATTGCTAATATAAAAAAAAGAAAAAAAAAAAAAGAAGAGGAATGAGGGGGCAGCCCGTGGGAGAGAGGCCTGGGAGCGAANAAGGTGGAAGGANGNGTAAGAGCAGGGGGGGGGTTTTTTTTTTAAAAGGATAAGAGGAGGGGTGGGAGGGGGCGGCAACGANAGAGTTATN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAGTCTTGGCAGCCC