ORFeome > rpl28 ORF2 – XORFeome v1.0

rpl28 ORF2 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl28
Gene ID: 1016759
Gene Page ID: 1016752
ORF Xenbase ID: 17294235

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078544
Original XGC clone length: 414

Human orthology & disease relationships

NCBI Entrez ID: 6158
Ensembl gene IDs: ENSG00000108107
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 172700,233700,233710,260540,306400,600274,601104,603896,607485

Library Location

Plate ID: GDExl11004
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ839640
dbEST ID: 79657342
Trimmed Sequence: ATGTCTGCTCACTTGCAATGGATGGTTATTCGCAATTGCTCCAGCTTTATTGTAAAGAGAAACCATCAGGTCTTTAGTACGGAGCCAAACAATCTGAAGGCAAGAAACTCCTTTCGGTACAATGGCCTGATCCACAAGAAAACAGTTGGAGTTCAGCCTGCAGCTGATGGAAAGGGGGTCATTGTTGTGCTAAAGAAGCGTGCAGGTCAGCGCAAGCCTGCAACATCTTATGAAAAAATTTCCATAAACAAGAACTCCCGCTCCACTCTGAGCAGCGTGCGTCACATTATCCGCAAGAACAACTACAGGAAGGATCTCCGCATGGCTGCTCTCCGTCGTGCTAGTGCTATTCTGAAGAGCCAGAAACCAGTTGTGGTGAAGAAGAAGCGCACCCGGGCAGCCAAGACTGCATT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGCTCACTTGCAATGGATGGTTATTCGCAATTGCTCCAGCTTTATTGTAAAGAGAAACCATCAGGTCTTTAGTACGGAGCCAAACAATCTGAAGGCAAGAAACTCCTTTCGGTACAATGGCCTGATCCACAAGAAAACAGTTGGAGTTCAGCCTGCAGCTGATGGAAAGGGGGTCATTGTTGTGCTAAAGAAGCGTGCAGGTCAGCGCAAGCCTGCAACATCTTATGAAAAAATTTCCATAAACAAGAACTCCCGCTCCACTCTGAGCAGCGTGCGTCACATTATCCGCAAGAACAACTACAGGAAGGATCTCCGCATGGCTGCTCTCCGTCGTGCTAGTGCTATTCTGAAGAGCCAGAAACCAGTTGTGGTGAAGAAGAAGCGCACCCGGGCAGCCAAGACTGCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAACAAAAACCCATGTCACAAATCTCATGATGTAACACTNNNNNAAACTTNNCNNNNNNNNNTTNNNNNCNCTCCTCTTCGNGGGNCGAGAAAAAAAAAAAAAAAAGTGTAATAAACTACATCCACCGAAAGCCCCTCACCCCCCCGCGCGTGGAGATATTTGTCCTCCACCCCCGCCCCCCCCGCCCCCGCCGGCTCCGCGGAGACCACGCGCAGCCGGGGGGGGAAATGTCCAGAATAAGAAATATTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGCTCACTTGCAATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839639
dbEST ID: 79657341
Trimmed Sequence: TGCAGTCTTGGCTGCCCGGGTGCGCTTCTTCTTCACCACAACTGGTTTCTGGCTCTTCAGAATAGCACTAGCACGACGGAGAGCAGCCATGCGGAGATCCTTCCTGTAGTTGTTCTTGCGGATAATGTGACGCACGCTGCTCAGAGTGGAGCGGGAGTTCTTGTTTATGGAAATTTTTTCATAAGATGTTGCAGGCTTGCGCTGACCTGCACGCTTCTTTAGCACAACAATGACCCCCTTTCCATCAGCTGCAGGCTGAACTCCAACTGTTTTCTTGTGGATCAGGCCATTGTACCGAAAGGAGTTTCTTGCCTTCAGATTGTTTGGCTCCGTACTAAAGACCTGATGGTTTCTCTTTACAATAAAGCTGGAGCAATTGCGAATAACCATCCATTGCAAGTGAGCAGACATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCAGTCTTGGCTGCCCGGGTGCGCTTCTTCTTCACCACAACTGGTTTCTGGCTCTTCAGAATAGCACTAGCACGACGGAGAGCAGCCATGCGGAGATCCTTCCTGTAGTTGTTCTTGCGGATAATGTGACGCACGCTGCTCAGAGTGGAGCGGGAGTTCTTGTTTATGGAAATTTTTTCATAAGATGTTGCAGGCTTGCGCTGACCTGCACGCTTCTTTAGCACAACAATGACCCCCTTTCCATCAGCTGCAGGCTGAACTCCAACTGTTTTCTTGTGGATCAGGCCATTGTACCGAAAGGAGTTTCTTGCCTTCAGATTGTTTGGCTCCGTACTAAAGACCTGATGGTTTCTCTTTACAATAAAGCTGGAGCAATTGCGAATAACCATCCATTGCAAGTGAGCAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTAAAAAAAAAAAATCATTTACACGAAAATAAAACTGGGCGAAAACCAGGCGGCGCTAAAACCTCACCTCCCCTCTCTGAAAAAAAAAGAGAGATACTTTTAGTGTATTGGTAGAGGGCCCCCCCTCCCAACACACCGCCCCCCGCTGAAAATAAAAAAAAAAAATAGCCCCCCCGCCGGCGGCCGCGCCCTTTTTTTCCCACGGGGGGGGGGGGGGGGGGGGGGGGGGAGTGCTGGGGNTGGGTGAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAGTCTTGGCTGCCC