ORFeome > rpl29 ORF1 – XORFeome v1.0

rpl29 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl29
Gene ID: 5789874
Gene Page ID: 5789750
ORF Xenbase ID: 17294241

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053776
Original XGC clone length: 228

Human orthology & disease relationships

NCBI Entrez ID: 6159
Ensembl gene IDs: ENSG00000162244
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11002
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ839311
dbEST ID: 79657013
Trimmed Sequence: ATGGCAAAGTCCAAGAATCACACAACTCACAACCAATCTCGCAAATGGCACAGAAATGGCATTAAGAAGCCCGTATCTCAAAGATATGAATCTCTAAAGGGGGTTGATCCTAAGTTCTTGAGAAACATGCGCTTTGCCAAGAAACACAACAAGAAAGGAATAAAGAAAATGCTGGCAAACAACGCAAAGTTTGCAGCCAGCGCCCAAGCCCCTGCACCCGCTAAATT
Full Trace Sequence: GGAGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCNTTGCAACAAATTGATGAACAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAAAGTCCAAGAATCACACAACTCACAACCAATCTCGCAAATGGCACAGAAATGGCATTAAGAAGCCCGTATCTCAAAGATATGAATCTCTAAAGGGGGTTGATCCTAAGTTCTTGAGAAACATGCGCTTTGCCAAGAAACACAACAAGAAAGGAATAAAGAAAATGCTGGCAAACAACGCAAAGTTTGCAGCCAGCGCCCAAGCCCCTGCACCCGCTAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCAAAATCAAAAAATAACAAAGAATACATTAGCCCCAATAGGGGAACAAGGGAGGAAAAGAAACAAAATAAGGTGCATCCAGAAATGCGGGGATTAGATGCCTTGGAATCGGGTGGGGGCAAGAGCGGGGGGGAGAAACATTTCGGGGGGAAGGGTTGAAAGGGAGAAACCAAGGGGGCAAAAAGTGGGGCCAAATTTTGAAAAAATGAAAGGGGGGAAGGGGGCGCCGGCCCGTTCCACGGGGTTTGAAAAATGTTATTGGGGGGGAACGGGGTGGGCCCGGGGCCCACAGGGCCGGATTTTCTTTGGGCTGGGGGTAAGATTTTGTTTTTTTTAGGGGGAAAACAACCATTTCCCCCCCGGGGGCACCCCCCCCCCACACAACAACGCTCATCTTATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAAAGTCCAAGAATCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839310
dbEST ID: 79657012
Trimmed Sequence: TTTAGCGGGTGCAGGGGCTTGGGCGCTGGCTGCAAACTTTGCGTTGTTTGCCAGCATTTTCTTTATTCCTTTCTTGTTGTGTTTCTTGGCAAAGCGCATGTTTCTCAAGAACTTAGGATCAACCCCCTTTAGAGATTCATATCTTTGAGATACGGGCTTCTTAATGCCATTTCTGTGCCATTTGCGAGATTGGTTGTGAGTTGTGTGATTCTTGGACTTTGCCATGG
Full Trace Sequence: GCGAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCANGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTAGCGGGTGCAGGGGCTTGGGCGCTGGCTGCAAACTTTGCGTTGTTTGCCAGCATTTTCTTTATTCCTTTCTTGTTGTGTTTCTTGGCAAAGCGCATGTTTCTCAAGAACTTAGGATCAACCCCCTTTAGAGATTCATATCTTTGAGATACGGGCTTCTTAATGCCATTTCTGTGCCATTTGCGAGATTGGTTGTGAGTTGTGTGATTCTTGGACTTTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACAATACAAAGAATTACAATAAAAAGACATGCCTGTTTCATGACAGCAAAGGCCCGTGTCACAAAATCTCTCTATCTTAAAGTGGGGGGGTACGGATTCCGGTAATTTGGAGAGGGGCCGACCCCCGAAGACGAACCCTTCCCGGGGGACAAGTGGGAGGGTAGGGAAAAACCGCCCCAAAAAGAGTGGCCAAAAACTTGGCGGAGACCAATTTGGGAACCGGGCGAAAAGGCGGTTCCACGGGGGGTTAAAATTTTTTTTGGGGGGTAATTTTTTCGCCCCGGGCCCNACAAGCGGCCGTTGTTACCCCGGGGGGTGCGTAGTTTTGGTTTGTGGGGAGATCAATTTGTTTCCCATAGGGGGGCCCTCCCCTCAAACAAAAATTCTACANTTGACGGGGAGGGGGTGGGGGTGGTNGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTAGCGGGTGCAGGGGCTT