ORFeome > rpl3 ORF1 – XORFeome v1.0

rpl3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpl3
Gene ID: 971707
Gene Page ID: 971702
ORF Xenbase ID: 17294253

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042242
Original XGC clone length: 1212

Human orthology & disease relationships

NCBI Entrez ID: 6122
Ensembl gene IDs: ENSG00000100316
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,180105,219500,400042,603896,608688

Library Location

Plate ID: GDExl11016
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ824317
dbEST ID: 79642019
Trimmed Sequence: ATGTCTCACCGAAAGTTCTCAGCCCCCCGACATGGATCCCTGGGCTTCTTGCCCCGCAAACGTTGTAAGAGACATCGTGGCAAAGTGAAGAGCTTCCCCAAGGATGACCCAAGCAAACCCATTCACCTGACCGCTTTCTTGGGCTACAAGGCTGGCATGACTCACATTGTTCGTGAGGTCGACCGACCTGGCTCAAAGGTGAACAAGAAAGAGGTTGTGGAAGCAGTAACTGTGGTTGAAACACCTCCCATGGTAATTGTTGGTATTGTTGGCTATGTCCAGACTCCTCGTGGTCTGCGCAGCTTGAAGACCATCTTTGCTGAGCACATCAGTGATGAATGCAAGAGGCGCTTCTACAAGAACTGGTACAAATCCAAGAAGAAGGCGTTCACAAAGTACTGCAAGAAATGGCAGGATGAAGACGGAAAGAAACAGCTGGAGAAGGACTTTGCTAGCATGAAAAAGTACTGCCAAGTCATCAGGGTTATTGCCCATACACAGATGCGTCTGCTTCCCCTGCGCCAGAAGAAGTCTCACCTCATGGAGATTCAAGTGAACGGAGGTACAATTGCAGAGAAGGTGGACTGGGCCCGTGAGAAACTGGAGCAACAAGTTGTAATTGGAGGAGTGTTCGGGCAGGATGAAATGATTGATGTGATTGGTGTCACTAAAGGAAAAGGCTACAAAGGTGTAACTAGGCCGTGGCACACAAAGAAACTGCCCCGTAAGACTCACAGAGGTTCTTCGTAAAGTGGCTTGGTATTGGGAGCTTGGCATTCCTGCCCCGGTGTGGGCTTTTTCTC
Full Trace Sequence: GGCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTCACCGAAAGTTCTCAGCCCCCCGACATGGATCCCTGGGCTTCTTGCCCCGCAAACGTTGTAAGAGACATCGTGGCAAAGTGAAGAGCTTCCCCAAGGATGACCCAAGCAAACCCATTCACCTGACCGCTTTCTTGGGCTACAAGGCTGGCATGACTCACATTGTTCGTGAGGTCGACCGACCTGGCTCAAAGGTGAACAAGAAAGAGGTTGTGGAAGCAGTAACTGTGGTTGAAACACCTCCCATGGTAATTGTTGGTATTGTTGGCTATGTCCAGACTCCTCGTGGTCTGCGCAGCTTGAAGACCATCTTTGCTGAGCACATCAGTGATGAATGCAAGAGGCGCTTCTACAAGAACTGGTACAAATCCAAGAAGAAGGCGTTCACAAAGTACTGCAAGAAATGGCAGGATGAAGACGGAAAGAAACAGCTGGAGAAGGACTTTGCTAGCATGAAAAAGTACTGCCAAGTCATCAGGGTTATTGCCCATACACAGATGCGTCTGCTTCCCCTGCGCCAGAAGAAGTCTCACCTCATGGAGATTCAAGTGAACGGAGGTACAATTGCAGAGAAGGTGGACTGGGCCCGTGAGAAACTGGAGCAACAAGTTGTAATTGGAGGAGTGTTCGGGCAGGATGAAATGATTGATGTGATTGGTGTCACTAAAGGAAAAGGCTACAAAGGTGTAACTAGGCCGTGGCACACAAAGAAACTGCCCCGTAAGACTCACAGAGGTTCTTCGTAAAGTGGCTTGGTATTGGGAGCTTGGCATTCCTGCCCCGGTGTGGGCTTTTTCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCACCGAAAGTTCTCAGCC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CGGCGGCCCGGAGCAACACGCATCATAGTGCACAGTATTGATAGATCACCTCACCTACACTTACTGAGTGTGAGGATACTCAGCGCGTGCGTAGCGAGCAAATATAGAGTAGTATTATTTATTGTTGGCACGTGGATGAGCTGCACGCTGGGTCTGCGTCGCGCACAGCAATATATAGTATGAACACATAGCGTCTCTCTTCTATCATATAGTCGCCATATCCTTTCTGTACAAAAAGAAGAAGTTAGAGACAAGAGCATTTCCACATCAATCATGTTCGCCATGTTAGTCTTGCATGGCTCGCGATAGACTACTCACCGCCCTTACTTCTTTCACCACCTCACGCGTTTCATTCTACGAGCTGAGTAAGAGCACACTCTAGACGCNCGACGTAATAAACACACTCAACGCGCCAGCCTCCGCACGCAGGAGACTCATTCTACCTATCCAGTGCATCACCCAAGCAGGCGTTCGATACTCTGCTACAGCGAGTGTATGCTTCTACTCATTACTGTGCGCTCATGCGTGCCGTCACATAGTGACCTACAGCATTATACATAGCAGTCGGATGATTGTCTCGATGGCGTATCTTGACTCAACAATGATCGACAGCTATCTGCCGTCAGAGGAAACAGAACTAGGTGAAACGATCGCTCTGAGAGGTCTTGGTCGAGTCATAGTTTCACCACACATGAAGAACTCGTGTATAGTCGCACCATCGTCTCCACAGACACTCGTCTGAGGTTCCGCTAGTTGGTACTTCGTATTTGTCTGGTTAGTATGACACACACAAACAAACATCCCTATCTAGGATACAGACGATACAACCGTCAGGATAGATCACTCGTGCAACACTAGGTCTCCTTGTTATCTTGTCTGCTGGCTCTTTAGGGGTAGACGATGTACTCTCCAAAGCCTCAGTTCCGTACTAGTCTTCATTCACCAGAGTCAATCTTCGAAGAGCACTCTCCACACCAAGTAAGAAGCACGGTCTCGTTACTTAACCGCCCTTCCTGGCCCCCGATACGTATTCTCGTTTGGGCACGTAGACTGTACAAGCCACTTGTCAGAGCCCCAAGGCCTTTGTGTACTACTCGCAAAACGAACTTCGAACCATCAGGATAGTTGCCGGTTGAACATGCCATCTCTAGCAAGGAGACCCTCAAACAACAAGCCCCACTGGGGACCGCCTGGATAAGGAACACAACAATAACCTAAGATTGGGCCCAGAGGAAGGAGACAGAGATTCACAAAACTTATAAAATGAAATATATATTCGGCAAAACCCCCTCCACAAGGGTGTCCCTCATACATCCCCGCGCCGCCCCAACACCCACACAGGGCCCACCACGAGAGTTTCGGCCCCCACCCACCTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAGTTTCCTCTTTTGCC