ORFeome > rpl34 ORF1 – XORFeome v1.0

rpl34 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl34
Gene ID: 957325
Gene Page ID: 957317
ORF Xenbase ID: 17294283

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053809
Original XGC clone length: 354

Human orthology & disease relationships

NCBI Entrez ID: 6164
Ensembl gene IDs: ENSG00000109475
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11003
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ839513
dbEST ID: 79657215
Trimmed Sequence: ATGGCTCCGCGTCTCACATACCGTCGTAGGCTGTCCTACAATACAACCTCCAACAAAACAAGACTATCCCGAACACCAGGTAACAGAATTGTGTACCTGTACACCAAGAAAGTTGGCAAAGCACCCAAATCTGCTTGTGGTATCTGCCCTGGAAGACTACGTGGTATCCGTGCTGTTAGACCTAAAGTGCTCATGAGACTTTCAAAGACTAAGAAGCATGTCAGCAGAGCTTATGGTGGATCCATGTGTGCAAAATGTGTTCGTGATAGAATTAAGCGGGCATTCCTTATTGAGGAGCAGAAGATTGTTGTGAAAGTATTGAAGGCACAGGCACAAAGCCAAAAGGCAAAGTT
Full Trace Sequence: TCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCCGCGTCTCACATACCGTCGTAGGCTGTCCTACAATACAACCTCCAACAAAACAAGACTATCCCGAACACCAGGTAACAGAATTGTGTACCTGTACACCAAGAAAGTTGGCAAAGCACCCAAATCTGCTTGTGGTATCTGCCCTGGAAGACTACGTGGTATCCGTGCTGTTAGACCTAAAGTGCTCATGAGACTTTCAAAGACTAAGAAGCATGTCAGCAGAGCTTATGGTGGATCCATGTGTGCAAAATGTGTTCGTGATAGAATTAAGCGGGCATTCCTTATTGAGGAGCAGAAGATTGTTGTGAAAGTATTGAAGGCACAGGCACAAAGCCAAAAGGCAAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCAAAAACAAGTCTCAAATCCTTTGATGTTACATGTTCGGTGGCTCGGGGGCTGGNTGTTGCTGCACAAAAAAAAAAAAGAAGGATTGTAGTTTTTACTGGGGGTGGGTGGAAGTGGCCCCCGGGAGAAACTCCCCTTGTGGGGTGTATTTGGGATGGAGGGAGCGGGCGCCGCGCGGGCCGCAAAACATGTAAGACAAGGGGTTGAGAAGGGGGGTGGTGTTTTTTTTTTTTGTTGATATTTATTATTTTAGATAACAAATAAAAAAAACCACCCACCCACCGCCCCCCCCAACCGCGAGTGACGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCCGCGTCTCACATA

Sequences - 3ʹ (reverse) EST

Accession: JZ839512
dbEST ID: 79657214
Trimmed Sequence: CTTTGCCTTTTGGCTTTGTGCCTGTGCCTTCAATACTTTCACAACAATCTTCTGCTCCTCAATAAGGAATGCCCGCTTAATTCTATCACGAACACATTTTGCACACATGGATCCACCATAAGCTCTGCTGACATGCTTCTTAGTCTTTGAAAGTCTCATGAGCACTTTAGGTCTAACAGCACGGATACCACGTAGTCTTCCAGGGCAGATACCACAAGCAGATTTGGGTGCTTTGCCAACTTTCTTGGTGTACAGGTACACAATTCTGTTACCTGGTGTTCGGGATAGTCTTGTTTTGTTGGAGGTTGTATTGTAGGACAGCCTACGACGGTATGTGAGACGCGGAGCCATGG
Full Trace Sequence: AAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTGCCTTTTGGCTTTGTGCCTGTGCCTTCAATACTTTCACAACAATCTTCTGCTCCTCAATAAGGAATGCCCGCTTAATTCTATCACGAACACATTTTGCACACATGGATCCACCATAAGCTCTGCTGACATGCTTCTTAGTCTTTGAAAGTCTCATGAGCACTTTAGGTCTAACAGCACGGATACCACGTAGTCTTCCAGGGCAGATACCACAAGCAGATTTGGGTGCTTTGCCAACTTTCTTGGTGTACAGGTACACAATTCTGTTACCTGGTGTTCGGGATAGTCTTGTTTTGTTGGAGGTTGTATTGTAGGACAGCCTACGACGGTATGTGAGACGCGGAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAAAAAAGAAAAATTTTACAATCTCTTCACTGAAATTGGAGACCGCCGGGAAAAAAACCAAAAACACCAAAACACAAGTGTGCCGTTGTCTCCCTGTTTTGGGGGGGAGCACGCCCACCCCAAAAAAAACCCGGGTGGGTGATTGAGAGGTGGGAGGGTGGTCGCCGCGCGGGGGGGAGAAAGAAAAAAAAACACAGGGGGGGGGAAGGGAAGGGTGTGTTGAAGTTATATATTTTATTTGTTGTTGNANANNGNNGGGGCGGCGCGNNGGNNNGNNANNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTGCCTTTTGGCTTTGTGCCT