ORFeome > rpl35a ORF1 – XORFeome v1.0

rpl35a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl35a
Gene ID: 1016064
Gene Page ID: 1016057
ORF Xenbase ID: 17294307

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053771
Original XGC clone length: 333

Human orthology & disease relationships

NCBI Entrez ID: 6165
Ensembl gene IDs: ENSG00000182899
Directly associated (OMIM) disease MIM numbers: 612528
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11001
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ839104
dbEST ID: 79656806
Trimmed Sequence: ATGTCTGGAAGATTGTGGTGCAAAGCCACTTTTGCTGGCTACAAGCGGGGCCTTCGAAATCAGACGGAGCACACGGCTCTTCTTAAAATTGAAGGAGTCTATGCTCGAGATGAAACCGAATTCTATTTTGGAAAAAGATGTGCCTACGTGTACAAAGCAAAAAATAACACAGTGACTCCTGGTGGAAAGCCCAACCGAACTCGTGTGATCTGGGGAAAGGTGACCCGAGCTCATGGAAACAGTGGCATGGTCCGTGCTAAGTTCCGCTCCAACCTCCCAGCTAAAGCCATTGGGCACAGAATCCGTGTGATGCTTTACCCATCAAGGATCTT
Full Trace Sequence: AGGGATCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGGAAGATTGTGGTGCAAAGCCACTTTTGCTGGCTACAAGCGGGGCCTTCGAAATCAGACGGAGCACACGGCTCTTCTTAAAATTGAAGGAGTCTATGCTCGAGATGAAACCGAATTCTATTTTGGAAAAAGATGTGCCTACGTGTACAAAGCAAAAAATAACACAGTGACTCCTGGTGGAAAGCCCAACCGAACTCGTGTGATCTGGGGAAAGGTGACCCGAGCTCATGGAAACAGTGGCATGGTCCGTGCTAAGTTCCGCTCCAACCTCCCAGCTAAAGCCATTGGGCACAGAATCCGTGTGATGCTTTACCCATCAAGGATCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTAACACGAGTCTCAGAATCTCTGATGTTACATCCGGGNNCCCCGGGCGGTCGGNGTGCCCCGGGTCCAAAAAAACAAAGGATCCAGCTTATTCTCATCTGTTACCGAGAACCCGCCCAGACAAAGAAAAACCCCCGGTTCGTTATTAACGTTAGGAGGCACGGGGGCAACCGCGCCCGGGGGACAGAATTTTGAGAGACCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGGAAGATTGTGGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839103
dbEST ID: 79656805
Trimmed Sequence: GATCCTTGATGGGTAAAGCATCACACGGATTCTGTGCCCAATGGCTTTAGCTGGGAGGTTGGAGCGGAACTTAGCACGGACCATGCCACTGTTTCCATGAGCTCGGGTCACCTTTCCCCAGATCACACGAGTTCGGTTGGGCTTTCCACCAGGAGTCACTGTGTTATTTTTTGCTTTGTACACGTAGGCACATCTTTTTCCAAAATAGAATTCGGTTTCATCTCGAGCATAGACTCCTTCAATTTTAAGAAGAGCCGTGTGCTCCGTCTGATTTCGAAGGCCCCGCTTGTAGCCAGCAAAAGTGGCTTTGCACCACAATCTTCCAGACATGG
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTNCNNCNNATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAAGATCCTTGATGGGTAAAGCATCACACGGATTCTGTGCCCAATGGCTTTAGCTGGGAGGTTGGAGCGGAACTTAGCACGGACCATGCCACTGTTTCCATGAGCTCGGGTCACCTTTCCCCAGATCACACGAGTTCGGTTGGGCTTTCCACCAGGAGTCACTGTGTTATTTTTTGCTTTGTACACGTAGGCACATCTTTTTCCAAAATAGAATTCGGTTTCATCTCGAGCATAGACTCCTTCAATTTTAAGAAGAGCCGTGTGCTCCGTCTGATTTCGAAGGCCCCGCTTGTAGCCAGCAAAAGTGGCTTTGCACCACAATCTTCCAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGGAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCCACCTTAAGAAAGAAAGGTCATTAACAACGCCTGGACCGAACTGTTNNCNTGCAGACTTGACCCGTTTTCCCAAAAAAAAAAATTTACAAANANNAANNNCNNNANNNTNNNGNNNATGAAGAGCNTTAACNNNAGGAANAANGAAGANNGGGGGNGNGGAAGCNGGGNNAGGANNAANNNANACTNAATCTNNANATGGNNNTNNNNANNAAANNNNTAANAATNNNNATAGGTTNNANGNNNNATAGNAANANNNNNGNTNNNAGTNNGNNNTANANNNNNNNNNNNNNGNNCNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATCCTTGATGGGTAAAGCA