ORFeome > rpl36 ORF1 – XORFeome v1.0

rpl36 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl36
Gene ID: 969198
Gene Page ID: 969191
ORF Xenbase ID: 17294313

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078556
Original XGC clone length: 318

Human orthology & disease relationships

NCBI Entrez ID: 25873
Ensembl gene IDs: ENSG00000130255
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,105120,108120,115200,131950,145980,182290,215600,226650,226670,603896,607841,609285

Library Location

Plate ID: GDExl11004
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ839624
dbEST ID: 79657326
Trimmed Sequence: ATGGCTATCCGGTACCCTATGGCTGTGGGCCTTAATAAAGGCCATCGTGTCACCAAGAATGTCACTAAGCCCAGACACTGCCGCAGGAGAGGGCGTCTGACAAAACACACCAAGTTTGTCCGTGACATGATCCGCGAGGTCTGTGGATTCGCTCCTTATGAGAGACGTGCAATGGAATTGTTGAAGGTGTCAAAGGACAAGAGAGCACTTAAATTCATAAAGAAAAGGATTGGTACTCACATACGTGCCAAGAGAAAGAGAGAAGAACTGAGCAATGTTCTGGCAGCAATGAGAAAGGCTGCTGCCAAGAAGGATTT
Full Trace Sequence: GGGGCCTATAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTATCCGGTACCCTATGGCTGTGGGCCTTAATAAAGGCCATCGTGTCACCAAGAATGTCACTAAGCCCAGACACTGCCGCAGGAGAGGGCGTCTGACAAAACACACCAAGTTTGTCCGTGACATGATCCGCGAGGTCTGTGGATTCGCTCCTTATGAGAGACGTGCAATGGAATTGTTGAAGGTGTCAAAGGACAAGAGAGCACTTAAATTCATAAAGAAAAGGATTGGTACTCACATACGTGCCAAGAGAAAGAGAGAAGAACTGAGCAATGTTCTGGCAGCAATGAGAAAGGCTGCTGCCAAGAAGGATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGAAAAAAAATAAATGAAGTTACAAAATACAATACCCTCCCAAAACCCAAAAAAAAAAAAAAAACAAAAATAATATACAAAACAGGGGCGCGGTGGAACACGCTGGGGGAATAGAAGGAAAACCCCCCCCCGGAAGACAACACAATGGGCGGGGGGTTAAAAAATAGGTTTAAAAACACGACGAGCGGGACCCCACCCCCCGGCGCAACACACACCCCTGGCCGCGGGTGCTAAAAGCGGGTGAGTGAAATATTTTGTTTTGGGTTTCCTTCTTTTTTTATAGGTTGTTCCAAAAACCTCCACCCCACCAAAAACCACCCGGGGGGAGGAGAACCGGGCGGCGGCGCGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTATCCGGTACCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839623
dbEST ID: 79657325
Trimmed Sequence: ATCCTTCTTGGCAGCAGCCTTTCTCATTGCTGCCAGAACATTGCTCAGTTCTTCTCTCTTTCTCTTGGCACGTATGTGAGTACCAATCCTTTTCTTTATGAATTTAAGTGCTCTCTTGTCCTTTGACACCTTCAACAATTCCATTGCACGTCTCTCATAAGGAGCGAATCCACAGACCTCGCGGATCATGTCACGGACAAACTTGGTGTGTTTTGTCAGACGCCCTCTCCTGCGGCAGTGTCTGGGCTTAGTGACATTCTTGGTGACACGATGGCCTTTATTAAGGCCCACAGCCATAGGGTACCGGATAGCCATGG
Full Trace Sequence: GAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCCTTCTTGGCAGCAGCCTTTCTCATTGCTGCCAGAACATTGCTCAGTTCTTCTCTCTTTCTCTTGGCACGTATGTGAGTACCAATCCTTTTCTTTATGAATTTAAGTGCTCTCTTGTCCTTTGACACCTTCAACAATTCCATTGCACGTCTCTCATAAGGAGCGAATCCACAGACCTCGCGGATCATGTCACGGACAAACTTGGTGTGTTTTGTCAGACGCCCTCTCCTGCGGCAGTGTCTGGGCTTAGTGACATTCTTGGTGACACGATGGCCTTTATTAAGGCCCACAGCCATAGGGTACCGGATAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACAAAACAACAATTTACAAAAAAATGAACTGGCAACTCCGGACCCGCCGGGCAAAAAAAAAAAAAATCAAATCCCACAAAAAGGGGGGTGATTTTTCTTTGTTGGGGTGAAAGAAACAAACAAAAAAAAAAAACACCGAGGCGGGGGGTGTTTTTTGTGTGAGAGGGGGTGGGGGCGGGGCGCCCCCCCAGTGGAAAAAACCAGGTGGGGGGGGGGGGGGGGGGTTTGTGGTGGTTTGGTGTTAAGTGCTTTTGGGTGTGGGTTATTTCCCCGCGCCCCNCGCCCCAACCCAGCCGCTCCAACCGGGGCGGCGTGGTGTGTGGTGGGGGGTACGCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCTTCTTGGCAGCAGCCTT