ORFeome > rpl36a ORF1 – XORFeome v1.0

rpl36a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl36a
Gene ID: 974806
Gene Page ID: 974798
ORF Xenbase ID: 17294319

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078555
Original XGC clone length: 321

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ839663
dbEST ID: 79657365
Trimmed Sequence: ATGGTGAATGTTCCCAAGACCCGCCGGACCTACTGCAAGAAATGTGGCAGGCATCAGCCACACAAAGTGACCCAATACAAGAAGGGCAAGGATTCTCTGTACGCCCAGGGAAAAAGGCGTTATGACCGCAAACAAAGCGGCTATGGTGGCCAGACCAAGCCAATTTTCAGAAAGAAGGCTAAAACCACAAAGAAAATTGTCTTGAGACTGGAGTGTGTTGACTCAAACTGCCGATCAAAGAGAATGCTGGCAATCAAGCGATGCAAGCACTTTGAATTGGGAGGGGACAAGAAGAGAAAGGGTCAAGTCATCCAGTTCTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAATGTTCCCAAGACCCGCCGGACCTACTGCAAGAAATGTGGCAGGCATCAGCCACACAAAGTGACCCAATACAAGAAGGGCAAGGATTCTCTGTACGCCCAGGGAAAAAGGCGTTATGACCGCAAACAAAGCGGCTATGGTGGCCAGACCAAGCCAATTTTCAGAAAGAAGGCTAAAACCACAAAGAAAATTGTCTTGAGACTGGAGTGTGTTGACTCAAACTGCCGATCAAAGAGAATGCTGGCAATCAAGCGATGCAAGCACTTTGAATTGGGAGGGGACAAGAAGAGAAAGGGTCAAGTCATCCAGTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATATCTGTTTCCTGGCAGCTCTGGCCCGTAAAAAAAAAAATAAAATGTTAAATTATAAATCGGAATTAGACAGACGGAAAAAAAAAAATAAAAAAAAAATTTAATCAAAGGTGGGGGGCTGTACAATCGGGGGGGATAGGAAAAAGACAACAACTCCTTGGAACCCCCGGGCGCGGGGGGGGGAAAAATAAAGGGGAAAAAAGGGGGAAGGGGGGCGCCCCCAAAGTGATTAAAATGGCGGTGGGGTGGTGCCCCGTGGTTATTTTTTTGGTTTGGAATGTTGTGCCTCTGAGGGGGTCGTTTTATAAAAGCAAACCCCAAAAAGCCCCGCCGGGGAGGGACGCGCGCGGGGTTTGGGGGGGGGATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAATGTTCCCAAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839662
dbEST ID: 79657364
Trimmed Sequence: GAACTGGATGACTTGACCCTTTCTCTTCTTGTCCCCTCCCAATTCAAAGTGCTTGCATCGCTTGATTGCCAGCATTCTCTTTGATCGGCAGTTTGAGTCAACACACTCCAGTCTCAAGACAATCTTCTTTGTGGTCTTAGCCTTCTTTCTGAAAATTGGCTTGGTCTGGCCACCATAGCCGCTTTGTTTGCGGTCATAACGCCTTTTTCCCTGGGCGTACAGAGAATCCTTGCCCTTCTTGTATTGGGTCACTTTGTGTGGCTGATGCCTGCCACATTTCTTGCAGTAGGTCCGGCGGGTCTTGGGAACATTCACCATGG
Full Trace Sequence: GGGAAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAACTGGATGACTTGACCCTTTCTCTTCTTGTCCCCTCCCAATTCAAAGTGCTTGCATCGCTTGATTGCCAGCATTCTCTTTGATCGGCAGTTTGAGTCAACACACTCCAGTCTCAAGACAATCTTCTTTGTGGTCTTAGCCTTCTTTCTGAAAATTGGCTTGGTCTGGCCACCATAGCCGCTTTGTTTGCGGTCATAACGCCTTTTTCCCTGGGCGTACAGAGAATCCTTGCCCTTCTTGTATTGGGTCACTTTGTGTGGCTGATGCCTGCCACATTTCTTGCAGTAGGTCCGGCGGGTCTTGGGAACATTCACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAACCATTGCTCTTCTATTTGTTGCACCGAACAGTTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTTAAAAAAAAAAAAAAAAAAAATAAAATTCTTTCGCCTTTTTAAAAAACCCGGGGAAAAAAAGACAAAAATTGGTTCATCCGAATGGGGCGGTTGCCTTCCCTTGGGGGGGGGGGAGGCCACACCCGGGGGGAAGCACCCGTGGCGGGGGGGGGGTTATGTGGGAGGGCACCCCGCCCCCGCCCCNCNCCAAACACGGCACAAAGNGGGTGGGGGGGGGGGNGGNAGGGTTATTTTTTTTGTATTGTNNNNTGGGNNTNNGGGGGAGAGGGNNNNNAGANAATANNNNNAGNAAGAAGNTGGGGGAGGTGAAGAGAAGAAAGATAAATGTGTGAAAGGAAAGAGGNAGAAGAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAACTGGATGACTTGACCCT