ORFeome > rpl38 ORF1 – XORFeome v1.0

rpl38 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl38
Gene ID: 967901
Gene Page ID: 967892
ORF Xenbase ID: 17294331

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078548
Original XGC clone length: 213

Human orthology & disease relationships

NCBI Entrez ID: 6169
Ensembl gene IDs: ENSG00000172809
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11004
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ839638
dbEST ID: 79657340
Trimmed Sequence: ATGCCTCGCAAAATTGAAGAGATCAAAGACTTCCTACTGACAGCCAGAAGAAAAGATGCAAAATCTGTCAAGATCAAGAAAAACAAAGACAATGTTAAGTTCAAGGTGCGCTGCAGCAAATACCTGTACACTCTGGTCATTACAGACAAAGAGAAGGCAGAAAAACTGAAACAGTCTCTACCACCTGGTCTGTCTGTGAAGGAACTGAAGTT
Full Trace Sequence: GGGTTCTAGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTCGCAAAATTGAAGAGATCAAAGACTTCCTACTGACAGCCAGAAGAAAAGATGCAAAATCTGTCAAGATCAAGAAAAACAAAGACAATGTTAAGTTCAAGGTGCGCTGCAGCAAATACCTGTACACTCTGGTCATTACAGACAAAGAGAAGGCAGAAAAACTGAAACAGTCTCTACCACCTGGTCTGTCTGTGAAGGAACTGAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTGATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGAGCGATATCCCGGATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCACTGAAAAACATAAAAAAAAACATCATGCCAAAGTAGAAACAGAAGGGCAAAAAGAAGCGGCATCGTGCTCCGGAGGATGGGGGGTGGCGGTACCTTGTGGTTTGGCGGGGGCGCGGGGCGGGGACAAAAAACGGAACGGAACGGAAGCGAAAAGCGGGAGGGAAGCGCGGCAGGGGGGGGGCCAAAGGCTGGAACGGAAGACACCGTGGGGGCGGGGGCGGGGGGGGGTTTCAAATTTTGTTAAAAAATATTTGGGGGGGAAACGCCGGCCGGGGGGGGCTTCGGGGGGGGGGGGTAACCGGGTGGTCCCGGGGGAAAAATGTTAAAACCCCCAGGGAACCCCCAAAGCGACAACGGCCCCAAAAACACCCGGGAGATATAAAATAATAAAGAGAGGGAGTAGGGAAAGAAAACAAACCAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCGCAAAATTGAAGAGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ839637
dbEST ID: 79657339
Trimmed Sequence: CTTCAGTTCCTTCACAGACAGACCAGGTGGTAGAGACTGTTTCAGTTTTTCTGCCTTCTCTTTGTCTGTAATGACCAGAGTGTACAGGTATTTGCTGCAACGCACCTTGAACTTAACATTGTCTTTGTTTTTCTTGATCTTGACAGATTTTGCATCTTTTCTTCTGGCTGTCAGTAAGAAGTCTTTGATCTCTTCAATTTTGCGAGGCATGG
Full Trace Sequence: GGTAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCNNCNAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCAGTTCCTTCACAGACAGACCAGGTGGTAGAGACTGTTTCAGTTTTTCTGCCTTCTCTTTGTCTGTAATGACCAGAGTGTACAGGTATTTGCTGCAACGCACCTTGAACTTAACATTGTCTTTGTTTTTCTTGATCTTGACAGATTTTGCATCTTTTCTTCTGGCTGTCAGTAAGAAGTCTTTGATCTCTTCAATTTTGCGAGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGACCCGACCTTAATACTGGCCGTAATTTAAAAACAACATGACAGCATTAAGAATGAAAAGGGCATCCGGGACGGATAAGCGCCGAATAGCGGGGCCGGAGGGGGGGGGGGTCGTTTACCGGGATTCGGGGAGGGCCGGGCCTAGCGAAAAAAGAATATCGGTGCGGGACGAGACTCGGGAGGCTAGGCCTCCGCCGCGGGACAAAATTAAGACTGTGAAACCTGGGCGCGGGGCAAGGGGGTTTAAAGGGTTGGTAAAAAGGNTTTTGGGGACACGCAAACGGCGGGGGTAACACGAAGAAGGGGGCGGGGTTGGGGGGGGGGGGGTGAGGAGAGGGGGGAAAGTAAAAGAGGGGNGGGCCTGAAGGCAGGAAGATGNTGAGGAGAAAGGGAAGGAAAGAAAATGAAGAATAGAAGTAGAAGAAAGTGGGAGGTGTTGTNCNCGCGGNAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCAGTTCCTTCACAGACA