ORFeome > rpl39 ORF1 – XORFeome v1.0

rpl39 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl39
Gene ID: 6255573
Gene Page ID: 5895525
ORF Xenbase ID: 17294337

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099264
Original XGC clone length: 156

Human orthology & disease relationships

NCBI Entrez ID: 6170
Ensembl gene IDs: ENSG00000198918
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11005
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ840057
dbEST ID: 79657759
Trimmed Sequence: ATGTCGTCCCACAAGACATTCAAAATTAAGAGGTTTCTTGCCAAGAAGCAGAAACAGAACAGACCCATCCCACAGTGGATCCGCATGAAAACAGGCAACAAGATCAGATACAACTCAAAAAGGAGACACTGGAGAAGGACCAAGCTTGGCCTGTT
Full Trace Sequence: GGGGGGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGTCCCACAAGACATTCAAAATTAAGAGGTTTCTTGCCAAGAAGCAGAAACAGAACAGACCCATCCCACAGTGGATCCGCATGAAAACAGGCAACAAGATCAGATACAACTCAAAAAGGAGACACTGGAGAAGGACCAAGCTTGGCCTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTATTGGAAATATCAAAAGATAAATTATGCCTCATGTAGAGAACTGCAGGGAGAAAGGCCAAGAAATGGCTGCTTCCGAAGGATGGCGGGTGACGGTTATCCGGTGTTTGGAAGAGAGGGCGCACCCGAAGAACACAAAACCGACCGGGACGCAGCTTGAAGGGGAGAAGCAACGGGCCGGAAGGAGCCGGGCCAGAGGCCTGAACGAATGCACCGGTGGGAACGGGGCAATGGGCGGGTTGATGGGTTTGTTTGACTGGTTTTTTGGGGGTAAGGGGGGTGGCCCGGGGGGGCCAGGACACAAAACGGTTACGGCGGGGGGTCCAGTGTGTTGTTATTGTGACAAAAAAGAAGTACAACAAACCGGGGGGCCGCCCCCTAAACCACATTAAAAAATATAAATAGAAAAAGGGAAAGACAGCAAAAGTAAGCACCCAAACGATACAAATAAAAAAAAGTTTAAAGAAGTTCATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGTCCCACAAGACATT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGTAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTNCAACAAATTNATAANCAATGCTTTCTTATAATGCCAACTTTNTACAAAAAANTTNNCAACANGCCAANCTTGGTCCTTCTCCANTGTCTCCTTTTTNANTTNTATCTNATCTTNTTNCCTNTTTTCATNCNAATCCACTNTNTNATNNNTCTNTTCTNTTTCTACTTCTTNNCAAAAAACCTCTTAATTTTNAATNTCTTNTNAAACNACATNNTNCCAACTTTTTTATACAAANTTNNCATTATAAAAAANCATTTCTCATCAATTTNTTNCAACCAACANTTCACTATCANTCAAAATAAAATCATTATTTNCCACCCAACCTAAATACTCNTCCATTTAAAAACATAAAAACAAATTATAATACAACATTAATAAAATACAATACATAAAAAAAAATAAAAACCTCCTACCCAATCATATACCTTTACTTTTATCCTTTATATTTATTACACCTCCCCCCTAAATCACATAAAACTACTCTATACCCATTCTATAATTAAAAACCAAATCCCCCTCACACTCTTATTCAAAAACTTTTAACAACCCCAACACTNATAACTCCCCAACCCCNNATTTCATANCTTACTTATAACTAATATTTATTTTNTTAANNTCTATACCNCNNNCNACCAAACAAANAACACCTTAAACACNAANATCNATTTTNTTANNATTTNAAANAACAAANAAAAATAANNCCACNNNNNANNNNNCCNAANAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGCCAAGCTTGGTCCTTC