ORFeome > rpl39 ORF2 – XORFeome v1.0

rpl39 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpl39
Gene ID: 5895694
Gene Page ID: 5895525
ORF Xenbase ID: 17294343

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099285
Original XGC clone length: 156

Human orthology & disease relationships

NCBI Entrez ID: 6170
Ensembl gene IDs: ENSG00000198918
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11007
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ840188
dbEST ID: 79657890
Trimmed Sequence: ATGTCATCCCACAAGACATTCAAAATTAAGAGGTTTCTCGCCAAGAAGCAGAAACAGAACAGACCTATCCCACAGTGGATCCGCATGAAAACAGGCAACAAGATCAGATACAACTCAAAGAGGAGACACTGGAGAAGGACCAAGCTTGGCCTGTT
Full Trace Sequence: GGGGGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCNTTGCNCNNATTGATGANCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCATCCCACAAGACATTCAAAATTAAGAGGTTTCTCGCCAAGAAGCAGAAACAGAACAGACCTATCCCACAGTGGATCCGCATGAAAACAGGCAACAAGATCAGATACAACTCAAAGAGGAGACACTGGAGAAGGACCAAGCTTGGCCTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGGGTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGACTGAAAATCACAAAAGATACATTAATGCAAAAGATAGACAAGGCAGGAGCTAGCGGTCCACTAGAGGATCCTGGAAAGACTGGCCGCTGACGCGGTCCTACGCATGGTGGGGGGGTGACGCCGATGGGCGAAAACCGATGAGTGCACAGTTGCAGTGGAAAAACGCCTGGCCGAGGCGGAAGGCGGGAAGGCAGGTAACTAAGCGCTGGGAGCGGGGGGCGGGGAACCTGGGGGCTAGGGGGGGCGGTGGGAAAGGGGGCAGGGGGGGCTTTTAGGGGCTGGAAAAGAAGGGTTTTTTTGGGGGGCCAGTGTGAGGCTCTGGGGGGATCCCAAAGCCACAAAGGGGGGTGACCCCCGGGGGGGCCAGGGTTTTAAAGAGTTTTGGGGAAGCAGGGCCCGGGGAGGGTTTCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCATCCCACAAGACATTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ840187
dbEST ID: 79657889
Trimmed Sequence: CANGCCAANCTTGGTCCTTCTCCANTGTCTCCTCTTTGAGTTGTATCTGATCTTGTTGCCTGTTTTCATGCGGATCCACTGTGGGATAGGTCTGTTCTGTTTCTGCTTCTTGGCGAGAAACCTCTTAATTTTGAATGTCTTGTGGGATGACATGG
Full Trace Sequence: GGAAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTNCNNCNNATTNATAANCAATGCTTTCTTATAATGCCAACTTTNTACAAAAAANTTNNCAACANGCCAANCTTGGTCCTTCTCCANTGTCTCCTCTTTGAGTTGTATCTGATCTTGTTGCCTGTTTTCATGCGGATCCACTGTGGGATAGGTCTGTTCTGTTTCTGCTTCTTGGCGAGAAACCTCTTAATTTTGAATGTCTTGTGGGATGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCAACCTTTATACCGGCCATCGGAAAACATAAAAGAAAACGTAATTGCAAGATGTCGACCCTGCAGGGCAGACGAGAGAGAAAAGGGGTCGGCCCGGAAATGGCGGGGAGAGGGGTGCCGCGTATTGTGGAGGGGGGGCTAGGCCCCTGTGACAAGAGGATGATCGGGTGTGACGTTGGTGTAGATAAAAGCGAAATGGCGTAAGGCACCTGAACTGGAAGCTAAAAAAAACCACCCAGGCGGGGAGGGGGGAAAGGCGGTGGTCGAGGCTTGGTGGGGGTGTTTTGTCGGGTGTGTGGGGTGATACCTCGCGGGGGCAAGCCATAACTTCTTTGGGGCGGGAGTTCGATGGTTGTTGGTTTGGAAAGAAAACAAAGCCCCTCAACCCCGAGGGGCCCCCCGTCCCCCACCTTTAATATTAATAGAGAAAAAGGTGGGAGCGCAGGTGGTGGCCTTCCCCCCCCAACTAAAATGGGGTTCAGGTGTGGGGCTCCGCCAGCCCGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGCCAAGCTTGGTCCTTC