ORFeome > rpl4 ORF1 – XORFeome v1.0

rpl4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl4
Gene ID: 6255762
Gene Page ID: 968394
ORF Xenbase ID: 17294355

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054956
Original XGC clone length: 1206

Human orthology & disease relationships

NCBI Entrez ID: 6124
Ensembl gene IDs: ENSG00000174444
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,180105,219500,268000,400042,603896,608688,610015

Library Location

Plate ID: GDExl11001
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ839072
dbEST ID: 79656774
Trimmed Sequence: ATGGCGGTCAGCATGGCCTGCGCTCGTCCGCTAATATCAGTGTACTCTGAAAAGGGGGAAACATCTGGCAAAAATGTCACCATGCCTGCAGTGTTCAAGGCCCCTATTCGGCCTGATATTGTCAACTTTGTTCACACAAACCTGCGCAAGAATAACCGTCAACCCTACGCAGTGAGCAAGCTTGCTGGTCACCAAACAAGTGCTGAATCATGGGGAACAGGTCGAGCTGTTGCTCGTATTCCCCGTGTGCGCGGAGGAGGAACTCACCGTTCTGGTCAGGGTGCCTTTGGAAACATGTGTCGTGGTGGGCGTATGTTTGCCCCAACCAAGACCTGGAGACGCTGGCATCGTAGAGTCAATACGACCCAAAAGCGCTATGCGGTCTGCTCTGCACTGGCTGCCTCAGCCCTTCCTGCTCTTATTATGTCTAAAGGTCACCGTATTGAGGAGATCCCCGAGGTTCCCCTTGTTGTTGAAGATAAAGTGGAAAGCTATAAGAAAACAAAGGAAGCAGTCCTTTTGTTGAAGAAGCTGAAAGCCTGGAATGACATAAAGAAGGTTTATGCTTCTCAGCGTATGCGCGCCGGGAAAGGTAAGATGAGGAACAGACACCGAATTCAGCGCAGAGGGCCCTGTGGTATCTACAAATGAAATAACGGCATTTATAAACCCTTCAAAATATCCCCAGGATCACCCTTCCCAAGGTAACCAAACTGAAACCTTTGTAAGGCTTACTCCTGGGTGGCCACGGTGGGAACGGTTTCTGTTATTTTGGAAAAAAAAAAAACAA
Full Trace Sequence: CTCGCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTCAGCATGGCCTGCGCTCGTCCGCTAATATCAGTGTACTCTGAAAAGGGGGAAACATCTGGCAAAAATGTCACCATGCCTGCAGTGTTCAAGGCCCCTATTCGGCCTGATATTGTCAACTTTGTTCACACAAACCTGCGCAAGAATAACCGTCAACCCTACGCAGTGAGCAAGCTTGCTGGTCACCAAACAAGTGCTGAATCATGGGGAACAGGTCGAGCTGTTGCTCGTATTCCCCGTGTGCGCGGAGGAGGAACTCACCGTTCTGGTCAGGGTGCCTTTGGAAACATGTGTCGTGGTGGGCGTATGTTTGCCCCAACCAAGACCTGGAGACGCTGGCATCGTAGAGTCAATACGACCCAAAAGCGCTATGCGGTCTGCTCTGCACTGGCTGCCTCAGCCCTTCCTGCTCTTATTATGTCTAAAGGTCACCGTATTGAGGAGATCCCCGAGGTTCCCCTTGTTGTTGAAGATAAAGTGGAAAGCTATAAGAAAACAAAGGAAGCAGTCCTTTTGTTGAAGAAGCTGAAAGCCTGGAATGACATAAAGAAGGTTTATGCTTCTCAGCGTATGCGCGCCGGGAAAGGTAAGATGAGGAACAGACACCGAATTCAGCGCAGAGGGCCCTGTGGTATCTACAAATGAAATAACGGCATTTATAAACCCTTCAAAATATCCCCAGGATCACCCTTCCCAAGGTAACCAAACTGAAACCTTTGTAAGGCTTACTCCTGGGTGGCCACGGTGGGAACGGTTTCTGTTATTTTGGAAAAAAAAAAAACAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTCAGCATGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839071
dbEST ID: 79656773
Trimmed Sequence: CTTCGATTCTGCCGTCTTAGCCTCTGCCGTCTTAGCCTCTGCCCTGGCTTGCCTCTTTTTTGCTTTGGCCAGCTTGATCATTTTTGTTTTTGCATCCAGTGGCTTCTTTGCTTTAGGCTTACCATCATCTGGCTTCTTTTCTTTAGCTTTAATATTCTCAAGCTGCTGCAGGATAGCATGACGCCTTGCGGTCTTTGCATATGGGTTCAGCCTCATCATGATTCTTAGGTTCTTCAGTGGGTTCTTCTTCAGCTCCCTTCGCTTCACCTTTTTGTTTGGAGCACGCAGAGCCCGCTGGATCTCCTGACTTTTTAGGATTCTGGTCAGATCTGTGTTTGTCATCTTGTGCATTGGAAGGTTGTAATCTGCCTTCAGCTTGGCTGATTTGCGCCATGTACCGTAGAGATCATCTAATTTGCGGAATGCGCTTTCTGTCCAAATACAGAACCGTCCAACGTGGCCACCAGGAGCTAGCCTTAAAAGGTTCAGCTTGCTTACATTGAGGAGGGTGATACCTGGGATATTTCTGAAGGCTTTTATAATGCCGTTATTTTCATTGTAGATTACACAGGGGCCCTCTGCGCTGAATTCGGCGTCTGTTCCTCATCTTACCTTTCCCCGGCGCGCATACGCCGAGAAGCATAAAACTTTCTTTTTGTCCTTTCCAGGCTTTTCGCTTCCTTTCACAAAAAGGACTTGCTTTCCTTTGTTTTTCTTAATAGCCTTTTCCCCTTTTATTCTTTAACAAAACAAGGGGGGAC
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCGATTCTGCCGTCTTAGCCTCTGCCGTCTTAGCCTCTGCCCTGGCTTGCCTCTTTTTTGCTTTGGCCAGCTTGATCATTTTTGTTTTTGCATCCAGTGGCTTCTTTGCTTTAGGCTTACCATCATCTGGCTTCTTTTCTTTAGCTTTAATATTCTCAAGCTGCTGCAGGATAGCATGACGCCTTGCGGTCTTTGCATATGGGTTCAGCCTCATCATGATTCTTAGGTTCTTCAGTGGGTTCTTCTTCAGCTCCCTTCGCTTCACCTTTTTGTTTGGAGCACGCAGAGCCCGCTGGATCTCCTGACTTTTTAGGATTCTGGTCAGATCTGTGTTTGTCATCTTGTGCATTGGAAGGTTGTAATCTGCCTTCAGCTTGGCTGATTTGCGCCATGTACCGTAGAGATCATCTAATTTGCGGAATGCGCTTTCTGTCCAAATACAGAACCGTCCAACGTGGCCACCAGGAGCTAGCCTTAAAAGGTTCAGCTTGCTTACATTGAGGAGGGTGATACCTGGGATATTTCTGAAGGCTTTTATAATGCCGTTATTTTCATTGTAGATTACACAGGGGCCCTCTGCGCTGAATTCGGCGTCTGTTCCTCATCTTACCTTTCCCCGGCGCGCATACGCCGAGAAGCATAAAACTTTCTTTTTGTCCTTTCCAGGCTTTTCGCTTCCTTTCACAAAAAGGACTTGCTTTCCTTTGTTTTTCTTAATAGCCTTTTCCCCTTTTATTCTTTAACAAAACAAGGGGGGAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCGATTCTGCCGTCTT