ORFeome > rpl5 ORF2 – XORFeome v1.0

rpl5 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpl5
Gene ID: 983917
Gene Page ID: 983911
ORF Xenbase ID: 17294373

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042258
Original XGC clone length: 891

Human orthology & disease relationships

NCBI Entrez ID: 6125
Ensembl gene IDs: ENSG00000122406
Directly associated (OMIM) disease MIM numbers: 612561
Indirectly associated (Lage, et al.) disease MIM numbers: 180105,219500,268000,400042,603896,610015

Library Location

Plate ID: GDExl11016
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ824285
dbEST ID: 79641987
Trimmed Sequence: ATGGGGTTCGTAAAGGTCGTCAAGAACAAGGCTTATTTTAAGAGGTACCAGGTCAAGTTCCGCAGAAGGAGAGAGGGCAAGACCGATTACTATGCTCGCAAGCGACTGGTGATCCAGGATAAGAACAAGTACAATACTCCCAAGTACAGGATGATTGTACGTGTCACCAACAGAGACATCATCTGCCAGATTGCTTATGCTAGGATTGAGGGAGACATGATTGTATGTGCTGCTTATGCTCATGAGCTTCCCAAGTATGGTGTCAAAGTTGGGCTGACAAACTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCTCGTAGGCTTCTCAACAAATTCGGTCTGGACAAAGTATACGAAGGTCAAGTGGAAGTAACAGGAGATGAGTACAATGTAGAGAGCGTTGATGGTGAACCTGGTGCCTTTACATGCTACCTTGATGCCGGCCTCACCAGAACCACCACTGGAAACAAAGTTTTTGGTGCTCTTAAGGGAGCTGTGGATGGAGGTTTATCTATTCCACACAGTACCAAGCGATTCCCTGGCTATGACTCTGAAAGCAAAGAATTCAATGCTGAGGTCCACCGCAAGCACATCTTCGGCCTGAATATTGCAGAGTACATGCGTCTTCTGATCGAAGAAGATGAAGATGCATATAANAAACAGTTCTCCCAGTACATAAAGAATGGTGTCGCAGCAGATCAGTTGGAAGACATATACAAAAAAGCTCATGCAGGTATTCGGGGAGAATCCAGTGCACGAAAAGAAACCCCAGAAGGAAGTCAAAAAGAAGAAGGTGGGAACGGTGGCCAAAATTGTCTCTGGAAANCAAA
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGTTCGTAAAGGTCGTCAAGAACAAGGCTTATTTTAAGAGGTACCAGGTCAAGTTCCGCAGAAGGAGAGAGGGCAAGACCGATTACTATGCTCGCAAGCGACTGGTGATCCAGGATAAGAACAAGTACAATACTCCCAAGTACAGGATGATTGTACGTGTCACCAACAGAGACATCATCTGCCAGATTGCTTATGCTAGGATTGAGGGAGACATGATTGTATGTGCTGCTTATGCTCATGAGCTTCCCAAGTATGGTGTCAAAGTTGGGCTGACAAACTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCTCGTAGGCTTCTCAACAAATTCGGTCTGGACAAAGTATACGAAGGTCAAGTGGAAGTAACAGGAGATGAGTACAATGTAGAGAGCGTTGATGGTGAACCTGGTGCCTTTACATGCTACCTTGATGCCGGCCTCACCAGAACCACCACTGGAAACAAAGTTTTTGGTGCTCTTAAGGGAGCTGTGGATGGAGGTTTATCTATTCCACACAGTACCAAGCGATTCCCTGGCTATGACTCTGAAAGCAAAGAATTCAATGCTGAGGTCCACCGCAAGCACATCTTCGGCCTGAATATTGCAGAGTACATGCGTCTTCTGATCGAAGAAGATGAAGATGCATATAANAAACAGTTCTCCCAGTACATAAAGAATGGTGTCGCAGCAGATCAGTTGGAAGACATATACAAAAAAGCTCATGCAGGTATTCGGGGAGAATCCAGTGCACGAAAAGAAACCCCAGAAGGAAGTCAAAAAGAAGAAGGTGGGAACGGTGGCCAAAATTGTCTCTGGAAANCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGTTCGTAAAGGTCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829626
dbEST ID: 79647328
Trimmed Sequence: GCTGTCTGCCTTCTGCTGAGCTCTGAGGAAACTGGCTTTTTTCTGAGCAACACGGTCCTTTTTCTGTTCCAGAGACAATTTGGCACGGTTCCACCTCTTCTTTTTGACTTCCTTCTTGGGTTTCTTTTCGTGCACTGGATTCTCCCGAATACCTGCATGAGCCTTTTTGTATATGTCTTCCAACTGATCTGCTGCGACACCATTCTTTATGTACTGGGAGAACTGTTTTTTATATGCATCTTCATCTTCTTCGATCAGAAGACGCATGTACTCTGCAATATTCAGGCCGAAGATGTGCTTGCGGTGGACCTCAGCATTGAATTCTTTGCTTTCAGAGTCATAGCCAGGGAATCGCTTGGTACTGTGTGGAATAGATAAACCTCCATCCACAGCTCCCTTAAGAGCACCAAAAACTTTGTTTCCAGTGGTGGTTCTGGTGAGGCCGGCATCAAGGTAGCATGTAAAGGCACCAGGTTCACCATCAACGCTCTCTACATTGTACTCATCTCCTGTTACTTCCACTTGACCTTCGTATACTTTGTCCAGACCGAATTTGTTGAGAAGCCTACGAGCCAGCAGCAGGCCAGTACAATATGCTGCAGCATAGTTTGTCAGCCCAACTTGACACCATACTTGGGGAGCTCATGAGCATAAGCAGCACATACAATCATGTCTCCCTCAATCCTAGCATAGGCATCTGGGCAAAGAAGGTCTCTGTTGGGTGACACGTAACAATCACCCTGTGACCGTGGGGAAAATTTGAACCTGGTTCTTTTT
Full Trace Sequence: CGGGGTATCCGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGTCTGCCTTCTGCTGAGCTCTGAGGAAACTGGCTTTTTTCTGAGCAACACGGTCCTTTTTCTGTTCCAGAGACAATTTGGCACGGTTCCACCTCTTCTTTTTGACTTCCTTCTTGGGTTTCTTTTCGTGCACTGGATTCTCCCGAATACCTGCATGAGCCTTTTTGTATATGTCTTCCAACTGATCTGCTGCGACACCATTCTTTATGTACTGGGAGAACTGTTTTTTATATGCATCTTCATCTTCTTCGATCAGAAGACGCATGTACTCTGCAATATTCAGGCCGAAGATGTGCTTGCGGTGGACCTCAGCATTGAATTCTTTGCTTTCAGAGTCATAGCCAGGGAATCGCTTGGTACTGTGTGGAATAGATAAACCTCCATCCACAGCTCCCTTAAGAGCACCAAAAACTTTGTTTCCAGTGGTGGTTCTGGTGAGGCCGGCATCAAGGTAGCATGTAAAGGCACCAGGTTCACCATCAACGCTCTCTACATTGTACTCATCTCCTGTTACTTCCACTTGACCTTCGTATACTTTGTCCAGACCGAATTTGTTGAGAAGCCTACGAGCCAGCAGCAGGCCAGTACAATATGCTGCAGCATAGTTTGTCAGCCCAACTTGACACCATACTTGGGGAGCTCATGAGCATAAGCAGCACATACAATCATGTCTCCCTCAATCCTAGCATAGGCATCTGGGCAAAGAAGGTCTCTGTTGGGTGACACGTAACAATCACCCTGTGACCGTGGGGAAAATTTGAACCTGGTTCTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGTCTGCCTTCTGCT