ORFeome > rplp2 ORF1 – XORFeome v1.0

rplp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rplp2
Gene ID: 944343
Gene Page ID: 944336
ORF Xenbase ID: 17294427

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123168
Original XGC clone length: 348

Human orthology & disease relationships

NCBI Entrez ID: 6181
Ensembl gene IDs: ENSG00000177600
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11088
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ838122
dbEST ID: 79655824
Trimmed Sequence: ATGCGTTACGTAGCTGCTTATCTTCTGGCGGCCCTCGGGGGCACTGAAAGCCCTACCATTGCTGACCTGACAAAGATCCTCAACAGTGTTGGCATAGAAACCGATCAACATCGTGCAGAGAAGGTTGTTGGTGAACTGAAAGGCAAAAGCATTGATGAGATTATTGCCCAAGGTAACACCAAATTAGCCAGCATGCCATCTGGAGGTGCCGTGGCTGCTGCTGCCAGTGGTGGATCTGCTGCCCCTGCTGCTGGAGGATCAGCTGCTCCCGCTGAGGAGAAGAAAGACGAGAAGAAAGAAGAGTCTGAGGAGTCTGATGATGATATGGGATTTGGACTCTTTGATTT
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGTTACGTAGCTGCTTATCTTCTGGCGGCCCTCGGGGGCACTGAAAGCCCTACCATTGCTGACCTGACAAAGATCCTCAACAGTGTTGGCATAGAAACCGATCAACATCGTGCAGAGAAGGTTGTTGGTGAACTGAAAGGCAAAAGCATTGATGAGATTATTGCCCAAGGTAACACCAAATTAGCCAGCATGCCATCTGGAGGTGCCGTGGCTGCTGCTGCCAGTGGTGGATCTGCTGCCCCTGCTGCTGGAGGATCAGCTGCTCCCGCTGAGGAGAAGAAAGACGAGAAGAAAGAAGAGTCTGAGGAGTCTGATGATGATATGGGATTTGGACTCTTTGATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCAAAAAAAAAAAAAATAAAAAAAAATATAACATGCGGCCCCCCCCCGCCCGGAAAAAAAAAAAAGAACAAAAAAAAATACACAGGTTTGTGTTTAGTTCCTTTTTGGAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAGCGTTTTTTTTTTCTAAATTTATAAGATTTGTTGGGGGTGGCCCCCCCCTGGGGGAAAAAAAAAAAAAAAACCGGGAAGAAGGGGGGGGGGAGAGGTTCTTTTTTTTTNGTATATAAAATATTATAATTAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGTTACGTAGCTGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838121
dbEST ID: 79655823
Trimmed Sequence: ATCAAAGAGTCCAAATCCCATATCATCATCAGACTCCTCAGACTCTTCTTTCTTCTCGTCTTTCTTCTCCTCAGCGGGAGCAGCTGATCCTCCAGCAGCAGGGGCAGCAGATCCACCACTGGCAGCAGCAGCCACGGCACCTCCAGATGGCATGCTGGCTAATTTGGTGTTACCTTGGGCAATAATCTCATCAATGCTTTTGCCTTTCAGTTCACCAACAACCTTCTCTGCACGATGTTGATCGGTTTCTATGCCAACACTGTTGAGGATCTTTGTCAGGTCAGCAATGGTAGGGCTTTCAGTGCCCCCGAGGGCCGCCAGAAGATAAGCAGCTACGTAACGCATGG
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCAAAGAGTCCAAATCCCATATCATCATCAGACTCCTCAGACTCTTCTTTCTTCTCGTCTTTCTTCTCCTCAGCGGGAGCAGCTGATCCTCCAGCAGCAGGGGCAGCAGATCCACCACTGGCAGCAGCAGCCACGGCACCTCCAGATGGCATGCTGGCTAATTTGGTGTTACCTTGGGCAATAATCTCATCAATGCTTTTGCCTTTCAGTTCACCAACAACCTTCTCTGCACGATGTTGATCGGTTTCTATGCCAACACTGTTGAGGATCTTTGTCAGGTCAGCAATGGTAGGGCTTTCAGTGCCCCCGAGGGCCGCCAGAAGATAAGCAGCTACGTAACGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGAAAAACAATTACAAATCATGACTAGGAGGTCCGAGACGCCCCCCGACAAAAAAAAAAAAAAAACACAGGAACGGGGGGCCTTGGGTGTGTATGGGGGGGGGGGGACGGAAAAAAAAAAAGAAGGCGGCGCGGGGCGGAAAAGGGGGGGTGGATTTGTTTTGGTGGGGGGGTGAGGCAAGGAACCCACTGCCGAAAAAGGAGATTGGGGGTGGGGGCAAGGGGAGGTTATTTTTCCATGTTTTTGAAATCTNGTGGGCGCCCTCAAGAGGGANAGGGTNNCGNAGGGGNGNAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCAAAGAGTCCAAATCCCATATC