ORFeome > rprd1a ORF1 – XORFeome v1.0

rprd1a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rprd1a
Gene ID: 949989
Gene Page ID: 949982
ORF Xenbase ID: 17294469

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122498
Original XGC clone length: 978

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ838290
dbEST ID: 79655992
Trimmed Sequence: ATGGCGTCATTTACCGAACCGGCCCTGGAAAAGAAGCTGTCGGAGCTGAGCAACTCGCAGCAAAGTGTCCAGACGTTGTCGCTGTGGCTGATCCATCACCGAAAACACGCGGCGACTATAGTGACGGTCTGGCAGAAGGAACTCAGGAAAGCCAAGACAAGCCGGAAGCTGACTTTCTTGTACTTGGCCAATGATGTTATCCAGAACAGCAAGCGCAAAGGACCAGAGTTCACTCGCGAGTTTGAGAATGTGCTTTTGGATGCCTTTTCACATGTGTCTGGCGAGGCAGAGGACGGGTGCCGGAAGCCCTTGGAAAGGTTGCTGCACATCTGGCAGGAACGCGGTGTTTACACCTCTGATTTTATTCAACAGCTCAGACTGGCAATTGATAATGATGACAGCCCCAAGGAAGCACCAGTCAATGAGGAGAAATCGTTGAAACGCACCTTTCAGCAAATACAAGAGGAAGATGATGATTATCCGGGCAGCTACTCACCACAGGAAACTTCCTCTGGACCCCTTTTGACAGAAGACCTGGTCAAAGCTCTGCAAGATCTGGAGAATGCTGCGTCCGGAGATGCTGCCGTTAGGCAGAAGATTGCATCCCTCCCACAGGAAGTGCAAGATGTCTCCTTGCTGGAAAAAATCACAAATAAGGAAGCAGCAGAGCGTCTCTCAAAAACTGTGGACGAGGCTTGGCTGTTACTAGCTGAATTATAAGGGAAGGCTTGGGGGCGAAATTAGAAGAATCCAAAAACGTTTGGGAAAAAATTCCTTGTGGGAATAAACACAAAAAAACCCAAAAAGAACGTTTT
Full Trace Sequence: CGAGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTCATTTACCGAACCGGCCCTGGAAAAGAAGCTGTCGGAGCTGAGCAACTCGCAGCAAAGTGTCCAGACGTTGTCGCTGTGGCTGATCCATCACCGAAAACACGCGGCGACTATAGTGACGGTCTGGCAGAAGGAACTCAGGAAAGCCAAGACAAGCCGGAAGCTGACTTTCTTGTACTTGGCCAATGATGTTATCCAGAACAGCAAGCGCAAAGGACCAGAGTTCACTCGCGAGTTTGAGAATGTGCTTTTGGATGCCTTTTCACATGTGTCTGGCGAGGCAGAGGACGGGTGCCGGAAGCCCTTGGAAAGGTTGCTGCACATCTGGCAGGAACGCGGTGTTTACACCTCTGATTTTATTCAACAGCTCAGACTGGCAATTGATAATGATGACAGCCCCAAGGAAGCACCAGTCAATGAGGAGAAATCGTTGAAACGCACCTTTCAGCAAATACAAGAGGAAGATGATGATTATCCGGGCAGCTACTCACCACAGGAAACTTCCTCTGGACCCCTTTTGACAGAAGACCTGGTCAAAGCTCTGCAAGATCTGGAGAATGCTGCGTCCGGAGATGCTGCCGTTAGGCAGAAGATTGCATCCCTCCCACAGGAAGTGCAAGATGTCTCCTTGCTGGAAAAAATCACAAATAAGGAAGCAGCAGAGCGTCTCTCAAAAACTGTGGACGAGGCTTGGCTGTTACTAGCTGAATTATAAGGGAAGGCTTGGGGGCGAAATTAGAAGAATCCAAAAACGTTTGGGAAAAAATTCCTTGTGGGAATAAACACAAAAAAACCCAAAAAGAACGTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTCATTTACCGAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838289
dbEST ID: 79655991
Trimmed Sequence: TTCAGTTGAGAAAAGGTCCCCGGCAGAGGGGAGAGGTGCGAGCCCCCCAGTGACATTCGGAAGCAGCGAGAGGTCTGGGAGGCTCTGTATGTGCGATTTCAGTTCTTTCCGAACTTGCGTTACCCGTGCAAGTTTGTGCTTGTATTCCTCTAGCTTCTTCTCCTTGTTGCCGAGAACGTCCTTCTGGGTCTGTGTGTACTCCATCAGCATCTTTGCCAACTGCTTGCGATCATCTAGTTCTGCTGCAAGCCTCCCATTATACTCAGCTAGTAACAGGCAAGCCTCGTCCACAGTCTTTGAGAGACGCTCTGCTGCCTCCTTATCTGTGATTTTTTCCAGCAAGGAGACATCTTGCACTTCCTGTGGGAGGGATGCAATCTTCTGCCTAACGGCAGCATCTCCGGACGCAGCATTCTCCAGATCTTGCAGAGCTTTGACCAGGTCTTCTGTCAAAAGGGGTCCAGAGGAAGTTTCCTGTGGTGAGTAGCTGCCCGGATAATCATCATCTTCCTCTTGTATTTGCTGAAAGGTGCGTTGGGGCGATTTCTCCTCATTGACTGGTGCTTCCGTGGGGCTGTCGGGCTTATCAATTGCCCATCTGAACTGTTGAAAAAAATCAAAAGTGTAAAACCCGCGTTCCCGGCGGAAGTTGCACAAGCTTTCCCAAGGGCTTCGGGAAGCGGGCCCCGGCCCCGCCCAACCCCATGGTGAGAAGGGGATCCGGAGGGCCACAATTTCCAAAAACCCGCCAAGGAGAACCGCGGG
Full Trace Sequence: GAGCAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAGTTGAGAAAAGGTCCCCGGCAGAGGGGAGAGGTGCGAGCCCCCCAGTGACATTCGGAAGCAGCGAGAGGTCTGGGAGGCTCTGTATGTGCGATTTCAGTTCTTTCCGAACTTGCGTTACCCGTGCAAGTTTGTGCTTGTATTCCTCTAGCTTCTTCTCCTTGTTGCCGAGAACGTCCTTCTGGGTCTGTGTGTACTCCATCAGCATCTTTGCCAACTGCTTGCGATCATCTAGTTCTGCTGCAAGCCTCCCATTATACTCAGCTAGTAACAGGCAAGCCTCGTCCACAGTCTTTGAGAGACGCTCTGCTGCCTCCTTATCTGTGATTTTTTCCAGCAAGGAGACATCTTGCACTTCCTGTGGGAGGGATGCAATCTTCTGCCTAACGGCAGCATCTCCGGACGCAGCATTCTCCAGATCTTGCAGAGCTTTGACCAGGTCTTCTGTCAAAAGGGGTCCAGAGGAAGTTTCCTGTGGTGAGTAGCTGCCCGGATAATCATCATCTTCCTCTTGTATTTGCTGAAAGGTGCGTTGGGGCGATTTCTCCTCATTGACTGGTGCTTCCGTGGGGCTGTCGGGCTTATCAATTGCCCATCTGAACTGTTGAAAAAAATCAAAAGTGTAAAACCCGCGTTCCCGGCGGAAGTTGCACAAGCTTTCCCAAGGGCTTCGGGAAGCGGGCCCCGGCCCCGCCCAACCCCATGGTGAGAAGGGGATCCGGAGGGCCACAATTTCCAAAAACCCGCCAAGGAGAACCGCGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAGTTGAGAAAAGGTCCC