ORFeome > rps11 ORF1 – XORFeome v1.0

rps11 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rps11
Gene ID: 5894068
Gene Page ID: 5893561
ORF Xenbase ID: 17294499

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053813
Original XGC clone length: 477

Human orthology & disease relationships

NCBI Entrez ID: 6205
Ensembl gene IDs: ENSG00000142534
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 182290,219500,400042,600652,603278,603896,607841

Library Location

Plate ID: GDExl11001
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ839132
dbEST ID: 79656834
Trimmed Sequence: ATGGCGGACATTCAGACTGAGAGAGCCTATCAGAAGCAGCCGACCATCTTTCAGAACAAGAAGCGTGTTCTGCAGGGTGAGACCGGCAAGGAGAAGCTCCCACGTTACTACAGGAGTGTTGGCCTGGGATTCAAGACTCCAAGAGAGGCAATTGATGGCACCTACATTGACAAGAAATGTCCCTTTACTGGCAACGTATCCATTCGTGGCCGTATCCTTTCAGGAGTGGTGACAAAGATGAAGATGCAGAGGACTATAGTGATCCGCAGAGATTACCTCCATTACATTCGCAAGTACAACCGGTTTGAGAAGCGCCACAAGAATATGTCTGTCCACCTTTCCCCTTGTTTCAGGGATGTGCAGGTCGGAGACACTGTCACAGTCGGAGAATGTCGTCCCCTGAGCAAAACTGTCCGCTTCAATGTCCTGAAGGTGACCAAAGCGGCTGGGACTAANAAACAGTTCCAGAAGTTCTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGACATTCAGACTGAGAGAGCCTATCAGAAGCAGCCGACCATCTTTCAGAACAAGAAGCGTGTTCTGCAGGGTGAGACCGGCAAGGAGAAGCTCCCACGTTACTACAGGAGTGTTGGCCTGGGATTCAAGACTCCAAGAGAGGCAATTGATGGCACCTACATTGACAAGAAATGTCCCTTTACTGGCAACGTATCCATTCGTGGCCGTATCCTTTCAGGAGTGGTGACAAAGATGAAGATGCAGAGGACTATAGTGATCCGCAGAGATTACCTCCATTACATTCGCAAGTACAACCGGTTTGAGAAGCGCCACAAGAATATGTCTGTCCACCTTTCCCCTTGTTTCAGGGATGTGCAGGTCGGAGACACTGTCACAGTCGGAGAATGTCGTCCCCTGAGCAAAACTGTCCGCTTCAATGTCCTGAAGGTGACCAAAGCGGCTGGGACTAANAAACAGTTCCAGAAGTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCCTATTACATGGTTCTAGCTGTTTTAAAGAAAAAAAAGACCGTGTCTTAAATCTCCAAATGTTACAAAAAAAGGAGAAAAGGGCCATCTGCGGCGCCCCAAAAAGACGCGGGGGTTATTTCTTCGGGGTGAAGGGGGGGGGGCGACCCAATAAAAAAAAAAAAAAAAAAGAAGAAAGAAAAAAAAAAAAAAAAAATAACACCCCCGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACATTCAGACT

Sequences - 3ʹ (reverse) EST

Accession: JZ839131
dbEST ID: 79656833
Trimmed Sequence: GAACTTCTGGAACTGTTTCTTAGTCCCAGCCGCTTTGGTCACCTTCAGGACATTGAAGCGGACAGTTTTGCTCAGGGGACGACATTCTCCGACTGTGACAGTGTCTCCGACCTGCACATCCCTGAAACAAGGGGAAAGGTGGACAGACATATTCTTGTGGCGCTTCTCAAACCGGTTGTACTTGCGAATGTAATGGAGGTAATCTCTGCGGATCACTATAGTCCTCTGCATCTTCATCTTTGTCACCACTCCTGAAAGGATACGGCCACGAATGGATACGTTGCCAGTAAAGGGACATTTCTTGTCAATGTAGGTGCCATCAATTGCCTCTCTTGGAGTCTTGAATCCCAGGCCAACACTCCTGTAGTAACGTGGGAGCTTCTCCTTGCCGGTCTCACCCTGCAGAACACGCTTCTTGTTCTGAAAGATGGTCGGCTGCTTCTGATAGGCTCTCTCAGTCTGAATGTCCGCCATGG
Full Trace Sequence: CGGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAACTTCTGGAACTGTTTCTTAGTCCCAGCCGCTTTGGTCACCTTCAGGACATTGAAGCGGACAGTTTTGCTCAGGGGACGACATTCTCCGACTGTGACAGTGTCTCCGACCTGCACATCCCTGAAACAAGGGGAAAGGTGGACAGACATATTCTTGTGGCGCTTCTCAAACCGGTTGTACTTGCGAATGTAATGGAGGTAATCTCTGCGGATCACTATAGTCCTCTGCATCTTCATCTTTGTCACCACTCCTGAAAGGATACGGCCACGAATGGATACGTTGCCAGTAAAGGGACATTTCTTGTCAATGTAGGTGCCATCAATTGCCTCTCTTGGAGTCTTGAATCCCAGGCCAACACTCCTGTAGTAACGTGGGAGCTTCTCCTTGCCGGTCTCACCCTGCAGAACACGCTTCTTGTTCTGAAAGATGGTCGGCTGCTTCTGATAGGCTCTCTCAGTCTGAATGTCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGAAAAAAAAAAATTAAGACTGAACCGTCGATAACAACGCCCTTAACAGGGGGGGGAGGAGGGCCCCCGTCTTCCCGCCGCAAAAGGGGGGTTGGTATATAGCAAGTGGTAGGGGGGGGAGGCCGCNCCACGGAGAAGAAAAAAAAGAACAGAAAAAAAAAAATAGAAAAAGAAAAAAAGAGAGCGAGCGGAAAAAAAAAAGAAAGGAGAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAACTTCTGGAACTGTTTCTTAG