ORFeome > rps12 ORF1 – XORFeome v1.0

rps12 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rps12
Gene ID: 6256555
Gene Page ID: 972799
ORF Xenbase ID: 17294505

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044028
Original XGC clone length: 399

Human orthology & disease relationships

NCBI Entrez ID: 6206
Ensembl gene IDs: ENSG00000112306
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11016
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ824335
dbEST ID: 79642037
Trimmed Sequence: ATGGCCGAGGAAGGCATTTCTGCTGGAGGTGTAATGGATGTTAACACCGCACTGCAAGAGGTGCTTAAGACTGCTCTTATCCACGATGGCCTAGCTCGGGGAATTCGTGAAGCTGCCAAAGCTCTTGACAAACGCCAGGCCCACCTGTGTGTGTTGGCTTCCAACTGTGATGAGCCAATGTATGTCAAATTAGTGGAAGCCCTTTGTGCTGAGCACCAGATCAATCTTATAAAGGTTGATGACAACAAAAAACTCGGTGAATGGGTTGGTCTCTGCAAAATTGACAGAGAAGGAAAGCCCCGCAAAGTGGTTGGCTGCAGTTGTGTAGTTGTCAAGGATTATGGCAAAGAGTCTCAGGCCAAAGATGTCATCGAGGAATACTTCAAGAGCAAGAAATT
Full Trace Sequence: GCCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGAGGAAGGCATTTCTGCTGGAGGTGTAATGGATGTTAACACCGCACTGCAAGAGGTGCTTAAGACTGCTCTTATCCACGATGGCCTAGCTCGGGGAATTCGTGAAGCTGCCAAAGCTCTTGACAAACGCCAGGCCCACCTGTGTGTGTTGGCTTCCAACTGTGATGAGCCAATGTATGTCAAATTAGTGGAAGCCCTTTGTGCTGAGCACCAGATCAATCTTATAAAGGTTGATGACAACAAAAAACTCGGTGAATGGGTTGGTCTCTGCAAAATTGACAGAGAAGGAAAGCCCCGCAAAGTGGTTGGCTGCAGTTGTGTAGTTGTCAAGGATTATGGCAAAGAGTCTCAGGCCAAAGATGTCATCGAGGAATACTTCAAGAGCAAGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGAGTCCAATCAATAAAGATTTTCAAAACNTCTCCTTCCCCCTTTCCCGGGGCCGGCCGCCCTGGCCCTTTTCGTTGGTCCTCGGGCGCCCGCTTTTCTCCCCGATAAACACCCCCGGGTTTAGGTTCCCCGGCAGAATTTATCTAACTCCAGAAGTGCCCTGGCCCGGGGGGTTCACCCTCCGTCCCCCGGGGCGTGTTCAAAAATTATCACCTCGGGTACATCTCCCAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGAGGAAGGCATT

Sequences - 3ʹ (reverse) EST

Accession: JZ829694
dbEST ID: 79647396
Trimmed Sequence: TTTCTTGCTCTTGAAGTATTCCTCGATGACATCTTTGGCCTGAGACTCTTTGCCATAATCCTTGACAACTACACAACTGCAGCCAACCACTTTGCGGGGCTTTCCTTCTCTGTCAATTTTGCAGAGACCAACCCATTCACCGAGTTTTTTGTTGTCATCAACCTTTATAAGATTGATCTGGTGCTCAGCACAAAGGGCTTCCACTAATTTGACATACATTGGCTCATCACAGTTGGAAGCCAACACACACAGGTGGGCCTGGCGTTTGTCAAGAGCTTTGGCAGCTTCACGAATTCCCCGAGCTAGGCCATCGTGGATAAGAGCAGTCTTAAGCACCTCTNGCAGTGCGGTGTTAACATCCATTACACCTCCAGCAGAAATGCCTTCCTCGGCCATGG
Full Trace Sequence: GGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTGCTCTTGAAGTATTCCTCGATGACATCTTTGGCCTGAGACTCTTTGCCATAATCCTTGACAACTACACAACTGCAGCCAACCACTTTGCGGGGCTTTCCTTCTCTGTCAATTTTGCAGAGACCAACCCATTCACCGAGTTTTTTGTTGTCATCAACCTTTATAAGATTGATCTGGTGCTCAGCACAAAGGGCTTCCACTAATTTGACATACATTGGCTCATCACAGTTGGAAGCCAACACACACAGGTGGGCCTGGCGTTTGTCAAGAGCTTTGGCAGCTTCACGAATTCCCCGAGCTAGGCCATCGTGGATAAGAGCAGTCTTAAGCACCTCTNGCAGTGCGGTGTTAACATCCATTACACCTCCAGCAGAAATGCCTTCCTCGGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCGAGAAAAAGACTGGCCGTCGTTTTAAACCGGTTGGGACCTGGAAAGTTCCTTGGTCGCATTGTCGCGAAGCCTGAAAAACCCTAGATCTGCAATGCGAAAAAAAAATAAAAGGACTGTGAGGAGGATCTTATGCGAAAGTGTTAACCGTTAATAACACGGGCTTCCCAGTGACCAATCCTTGAAAGTTTTCCTACCGTTCTGGGGAGTGCAAACCAAGGAACGAAATCCCCCGGGCAGAATTCCATGCACACAAATCCTCCTCTAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTGCTCTTGAAGTATTCCTC