ORFeome > rps12 ORF2 – XORFeome v1.0

rps12 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rps12
Gene ID: 972806
Gene Page ID: 972799
ORF Xenbase ID: 17294511

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056655
Original XGC clone length: 399

Human orthology & disease relationships

NCBI Entrez ID: 6206
Ensembl gene IDs: ENSG00000112306
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11018
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ824454
dbEST ID: 79642156
Trimmed Sequence: ATGGCCGAGGAAGGCATTTCTGCTGGAGGTGTAATGGATGTAAACACTGCACTACAAGAGGTGCTTAAGACTGCTCTAATACACGATGGCCTCGCTCGAGGAATTCGTGAAGCTGCCAAAGCTCTTGACAAGCGCCAAGCTCACCTGTGTGTTTTGGCTTCCAACTGTGACGAGCCAATGTATGTCAAGTTAGTTGAAGCCCTTTGTGCTGAGCACCAGATCAATCTTATAAAGGTTGATGACAACAAGAAACTTGGTGAATGGGTTGGTCTCTGCAAAATTGATAGAGAAGGAAAACCCCGGAAAGTGGTTGGCTGCAGTTGTGTAGTTGTCAAGGATTATGGCAAGGAGTCTCAGGCAAAAGATGTCATAGAAGAATACTTCAAGATCAAGAAATT
Full Trace Sequence: GCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGAGGAAGGCATTTCTGCTGGAGGTGTAATGGATGTAAACACTGCACTACAAGAGGTGCTTAAGACTGCTCTAATACACGATGGCCTCGCTCGAGGAATTCGTGAAGCTGCCAAAGCTCTTGACAAGCGCCAAGCTCACCTGTGTGTTTTGGCTTCCAACTGTGACGAGCCAATGTATGTCAAGTTAGTTGAAGCCCTTTGTGCTGAGCACCAGATCAATCTTATAAAGGTTGATGACAACAAGAAACTTGGTGAATGGGTTGGTCTCTGCAAAATTGATAGAGAAGGAAAACCCCGGAAAGTGGTTGGCTGCAGTTGTGTAGTTGTCAAGGATTATGGCAAGGAGTCTCAGGCAAAAGATGTCATAGAAGAATACTTCAAGATCAAGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAATTCCTGAAATGTTACAAAATTNNTNNNNGNTTNNNGGNNTTNGGGGNTGTGGTTTTTTTGTGTGGTTGTCCTGCTGCCTCTTCTAATACCCGATAGCCACCTCTGGTTCCGGCTCTATCCAAAACTTTATCTGAAAGATTTACTTGCTTTTAAAACGGAGGATCAACATTCCGTCATCCCAGGGCTGCCCAAAATTAACCCCTCTGGTAAAATCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGAGGAAGGCATT

Sequences - 3ʹ (reverse) EST

Accession: JZ829808
dbEST ID: 79647510
Trimmed Sequence: TTTCTTGATCTTGAAGTATTCTTCTATGACATCTTTTGCCTGAGACTCCTTGCCATAATCCTTGACAACTACACAACTGCAGCCAACCACTTTCCGGGGTTTTCCTTCTCTATCAATTTTGCAGAGACCAACCCATTCACCAAGTTTCTTGTTGTCATCAACCTTTATAAGATTGATCTGGTGCTCAGCACAAAGGGCTTCAACTAACTTGACATACATTGGCTCGTCACAGTTGGAAGCCAAAACACACAGGTGAGCTTGGCGCTTGTCAAGAGCTTTGGCAGCTTCACGAATTCCTCGAGCGAGGCCATCGTGTATTAGAGCAGTCTTAAGCACCTCTTGTAGTGCAGTGTTTACATCCATTACACCTCCAGCAGAAATGCCTTCCTCGGCCATGG
Full Trace Sequence: ACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTGATCTTGAAGTATTCTTCTATGACATCTTTTGCCTGAGACTCCTTGCCATAATCCTTGACAACTACACAACTGCAGCCAACCACTTTCCGGGGTTTTCCTTCTCTATCAATTTTGCAGAGACCAACCCATTCACCAAGTTTCTTGTTGTCATCAACCTTTATAAGATTGATCTGGTGCTCAGCACAAAGGGCTTCAACTAACTTGACATACATTGGCTCGTCACAGTTGGAAGCCAAAACACACAGGTGAGCTTGGCGCTTGTCAAGAGCTTTGGCAGCTTCACGAATTCCTCGAGCGAGGCCATCGTGTATTAGAGCAGTCTTAAGCACCTCTTGTAGTGCAGTGTTTACATCCATTACACCTCCAGCAGAAATGCCTTCCTCGGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAACTGGCCGTCATATTACACAGCATGGAAAAAGGAAAAAGTCCCTTTACCACCTTTCTTCGCCCTCCTGAAGAATGCTCATACAAGAAATTCAAAATGGCAATTGAAAGACGGATGACCTGTTGAATGTGGGATAGGGGTCACCCCTTCGCCACCCCTGTTTCCCATGAAGCAAACTGAAATGGATTTTCCTTCGAGCTTTGAATTGAAAAACCACGGACCAAAATCCCAGGGCAGTTTTCCTAAACAATATAAAATCTCCCGAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTGATCTTGAAGTATTCT