ORFeome > rps15 ORF1 – XORFeome v1.0

rps15 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rps15
Gene ID: 5833061
Gene Page ID: 5832672
ORF Xenbase ID: 17294535

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053812
Original XGC clone length: 438

Human orthology & disease relationships

NCBI Entrez ID: 6209
Ensembl gene IDs: ENSG00000115268
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11001
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ839238
dbEST ID: 79656940
Trimmed Sequence: ATGGCGGAAGTTGAGCAGAAGAAGAAAAGGACCTTCAAGAAATTCACCTATCGAGGGGTGGACCTCGACCAGCTACTCGATATGTCCTATGAGCAGGTTATGCAGCTTTATTGTGCTCGGCAAAGGAGGCGTCTAAACCGCGGTCTCCGTCGCAAGCAGAACTCTCTTCTGAAGCGCCTGCGAAAGGCTAAGAAGGAGGCACCACCCATGGAAAAACCTGAGGTCATTAAAACTCACTTGAGGGACATGATCATCCTGCCAGAGATGGTAGGAAGCATGGTGGGAGTTTACAACGGCAAAGCCTTCAACCAGGTGGAAATCAAGCCTGAGATGATTGGCCATTACTTGGGCGAGTTTTCCATCACCTACAAGCCTGTGAAACACGGCAGACCTGGTATTGGTGCCACCCACTCCTCTCGCTTCATTCCGCTTAAGTT
Full Trace Sequence: GGGCGGTCTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAAGTTGAGCAGAAGAAGAAAAGGACCTTCAAGAAATTCACCTATCGAGGGGTGGACCTCGACCAGCTACTCGATATGTCCTATGAGCAGGTTATGCAGCTTTATTGTGCTCGGCAAAGGAGGCGTCTAAACCGCGGTCTCCGTCGCAAGCAGAACTCTCTTCTGAAGCGCCTGCGAAAGGCTAAGAAGGAGGCACCACCCATGGAAAAACCTGAGGTCATTAAAACTCACTTGAGGGACATGATCATCCTGCCAGAGATGGTAGGAAGCATGGTGGGAGTTTACAACGGCAAAGCCTTCAACCAGGTGGAAATCAAGCCTGAGATGATTGGCCATTACTTGGGCGAGTTTTCCATCACCTACAAGCCTGTGAAACACGGCAGACCTGGTATTGGTGCCACCCACTCCTCTCGCTTCATTCCGCTTAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCAAAAAAAAAACAAGACCGTGTCTCATAATCCATCCAGATAAAAGCCAAGAAAGAAATGCCACGAATTGCTCTGTTCCCAAGGGTGGGCGGGGGACCTAACCGGTTTATCGGGGGAGAAGAAAACAACGGATGAAGAAAAACCCTGGTCGGGGTGTTTATCTCTAACTGGGGAGTAAGAAAGCCCCCGTCACGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAAGTTGAGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839237
dbEST ID: 79656939
Trimmed Sequence: CTTAAGCGGAATGAAGCGAGAGGAGTGGGTGGCACCAATACCAGGTCTGCCGTGTTTCACAGGCTTGTAGGTGATGGAAAACTCGCCCAAGTAATGGCCAATCATCTCAGGCTTGATTTCCACCTGGTTGAAGGCTTTGCCGTTGTAAACTCCCACCATGCTTCCTACCATCTCTGGCAGGATGATCATGTCCCTCAAGTGAGTTTTAATGACCTCAGGTTTTTCCATGGGTGGTGCCTCCTTCTTAGCCTTTCGCAGGCGCTTCAGAAGAGAGTTCTGCTTGCGACGGAGACCGCGGTTTAGACGCCTCCTTTGCCGAGCACAATAAAGCTGCATAACCTGCTCATAGGACATATCGAGTAGCTGGTCGAGGTCCACCCCTCGATAGGTGAATTTCTTGAAGGTCCTTTTCTTCTTCTGCTCAACTTCCGCCATGG
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTAAGCGGAATGAAGCGAGAGGAGTGGGTGGCACCAATACCAGGTCTGCCGTGTTTCACAGGCTTGTAGGTGATGGAAAACTCGCCCAAGTAATGGCCAATCATCTCAGGCTTGATTTCCACCTGGTTGAAGGCTTTGCCGTTGTAAACTCCCACCATGCTTCCTACCATCTCTGGCAGGATGATCATGTCCCTCAAGTGAGTTTTAATGACCTCAGGTTTTTCCATGGGTGGTGCCTCCTTCTTAGCCTTTCGCAGGCGCTTCAGAAGAGAGTTCTGCTTGCGACGGAGACCGCGGTTTAGACGCCTCCTTTGCCGAGCACAATAAAGCTGCATAACCTGCTCATAGGACATATCGAGTAGCTGGTCGAGGTCCACCCCTCGATAGGTGAATTTCTTGAAGGTCCTTTTCTTCTTCTGCTCAACTTCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAAAAAATCATTATTTGGGGAACGAAATAAACACGGTCCGTCAATTAACACCGTCTGGGAAGGGGAATTTACAGGCAGGTCTGGCCCGTTGCTCAAAGTGCCCTGGGATTTAAAAGTGGGATTGGGGGAGACGCAAACAAAAAAGAAAAAACACGCCTTGCGATAAATTTGCNTTAAGAAGAAATACGCGCCCGCNGGNCNNGTGTCAAAAAGNTGGGGGGGAAGAGGNNTGGGGGAAGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTAAGCGGAATGAAGCGA