ORFeome > rps16 ORF3 – XORFeome v1.0

rps16 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256658
Gene Page ID:
ORF Xenbase ID: 17294559

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128923
Original XGC clone length: 441

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ838898
dbEST ID: 79656600
Trimmed Sequence: ATGCCGGCCAAGGGACCTTTGCAGTCAGTCCAAGTTTTTGGGCGGAAGAAAACTGCTACAGCTGTTGCCCACTGCAAAAGAGGCAATGGTCTTATCAAAGTTAATGGAAGACCTCTTGAAATGATTGAACCTGCAACATTACAGTACAAACTGCTGGAGCCTGTTCTTCTCTTGGGCAAGGAACGTTTTGCTGGTGTTGACATCAGAGTTCGTGTAAAGGGAGGTGGACATGTTGCTCAAGTCTATGCAATCCGACAGGCCATATCCAAGTCACTTGTAGCTTACTACCAGAAATATGTTGATGAAGCTTCCAAAAAGGAGATTAAAGACATCCTGATCCAGTATGACAGAACCCTCCTTGTTGCAGATCCCCGTCGTTGCGAGTCCAAGAAGTTTGGTGGACCTGGAGCCCGTGCTCGCTACCAGAAGTCCTACCGTTT
Full Trace Sequence: GCCCACAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGGCCAAGGGACCTTTGCAGTCAGTCCAAGTTTTTGGGCGGAAGAAAACTGCTACAGCTGTTGCCCACTGCAAAAGAGGCAATGGTCTTATCAAAGTTAATGGAAGACCTCTTGAAATGATTGAACCTGCAACATTACAGTACAAACTGCTGGAGCCTGTTCTTCTCTTGGGCAAGGAACGTTTTGCTGGTGTTGACATCAGAGTTCGTGTAAAGGGAGGTGGACATGTTGCTCAAGTCTATGCAATCCGACAGGCCATATCCAAGTCACTTGTAGCTTACTACCAGAAATATGTTGATGAAGCTTCCAAAAAGGAGATTAAAGACATCCTGATCCAGTATGACAGAACCCTCCTTGTTGCAGATCCCCGTCGTTGCGAGTCCAAGAAGTTTGGTGGACCTGGAGCCCGTGCTCGCTACCAGAAGTCCTACCGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACNTGAAAAATAAAAAAAAACCTGGCAACTCTGGCCCGTGTCTCAAACTCCCCTAAAGTTACAAGNNGGCCGCGGCTCCCCCGTCCCCCGGGGTCCCTGGGTTTTGGTTTTGTGGCGGGGGAGACCCCAAAACCAGAAAAAAAACCGGAAAGAAAAAAAAAAAAAGAAAAAGAAAAAAAAAGGACCCACAGGGCCAAAACAACCACAGAAAAAGGGGGGGGGAGGGGAGGGGGGGGTGTGTTTTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGGCCAAGGGACCTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838897
dbEST ID: 79656599
Trimmed Sequence: ACGGTAGGACTTCTGGTAGCGAGCACGGGCTCCAGGTCCACCAAACTTCTTGGACTCGCAACGACGGGGATCTGCAACAAGGAGGGTTCTGTCATACTGGATCAGGATGTCTTTAATCTCCTTTTTGGAAGCTTCATCAACATATTTCTGGTAGTAAGCTACAAGTGACTTGGATATGGCCTGTCGGATTGCATAGACTTGAGCAACATGTCCACCTCCCTTTACACGAACTCTGATGTCAACACCAGCAAAACGTTCCTTGCCCAAGAGAAGAACAGGCTCCAGCAGTTTGTACTGTAATGTTGCAGGTTCAATCATTTCAAGAGGTCTTCCATTAACTTTGATAAGACCATTGCCTCTTTTGCAGTGGGCAACAGCTGTAGCAGTTTTCTTCCGCCCAAAAACTTGGACTGACTGCAAAGGTCCCTTGGCCGGCATGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGGTAGGACTTCTGGTAGCGAGCACGGGCTCCAGGTCCACCAAACTTCTTGGACTCGCAACGACGGGGATCTGCAACAAGGAGGGTTCTGTCATACTGGATCAGGATGTCTTTAATCTCCTTTTTGGAAGCTTCATCAACATATTTCTGGTAGTAAGCTACAAGTGACTTGGATATGGCCTGTCGGATTGCATAGACTTGAGCAACATGTCCACCTCCCTTTACACGAACTCTGATGTCAACACCAGCAAAACGTTCCTTGCCCAAGAGAAGAACAGGCTCCAGCAGTTTGTACTGTAATGTTGCAGGTTCAATCATTTCAAGAGGTCTTCCATTAACTTTGATAAGACCATTGCCTCTTTTGCAGTGGGCAACAGCTGTAGCAGTTTTCTTCCGCCCAAAAACTTGGACTGACTGCAAAGGTCCCTTGGCCGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGAAACCGAACTTAAAACTGAACAATCATTTAACCAACATTAGAACCGGGTTTNTAAAAGAAAAACGCCGGTCCTAATATACCAGGGCTCTTGTTTTTTTAATTTTGTTTTGTGTGTGCCCCCCAAAAAAAAAAAAAAAAACACACCCAAAGTTTAAAATTTTTAAGAGAATATAAGAGAAAGAGAGGGGGGGCACCCCACCCCCACCCNNCAAAAAAAGAGAAGGAGGNAGAGGGGNCGGCN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGTAGGACTTCTGGTA