ORFeome > rps2 ORF1 – XORFeome v1.0

rps2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rps2
Gene ID: 1003623
Gene Page ID: 1003615
ORF Xenbase ID: 17294583

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056066
Original XGC clone length: 846

Human orthology & disease relationships

NCBI Entrez ID: 6187
Ensembl gene IDs: ENSG00000140988
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11020
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ824596
dbEST ID: 79642298
Trimmed Sequence: ATGGCGGACGACGCCGGTGGTAACAGGGGAGGTTTCCGCGGGGGGTTCGGCGGTGGTGGCAGAGGCCGCGGTCGTGGAAGAGGCAGGGGACGAGGCAGAGGACGCGGGGCCCGTGGCGGGAAAGCTGACGACAAGGAATGGGTGCCAGTCACCAAGCTTGGACGTCTAGTCAAGGACATGAAGATCAAGTCTTTGGAGGAAATCTATCTCTTCTCCCTGCCAATCAAGGAGTCTGAGATCATCGACTTCTTCCTGGGCTCCACCCTGAAGGACGAGGTGTTGAAGATCATGCCTGTGCAGAAACAGACCCGTGCTGGACAGAGAACCAGGTTCAAGGCTTTTGTGGCTATTGGTGACTACAACGGTCACGTTGGTCTCGGTGTGAAATGCTCCAAAGAAGTGGCCACGGCCATCCGGGGAGCCATCATCCTGGCCAAACTGTCCATCGTTCCTGTTCGTAGAGGTTATTGGGGTAACAAGATCGGCAAGCCGCACACTGTGCCCTGCAAGGTTACTGGCCGCTGTGGTTCTGGCGGGGGTGCGTCTGATCCCAGCCCCCAGAGGTACTGGGTATTGTGTCTGCTCCCTGTCCCCAGAAGCTGCTCATGATGGCTGGTATTGATGACTGCTACACATCAGCCAGGGGCTGCACTGCTACCTTGGGAAACTCGCTAAAGCCACCTTTGATGCCATCTCAAAGACTTACAGCTATCTGACTCCTGATCTCTGGAGGGGGACGGTGGTTCTCCCAATTTCCCTCACCAGGAGTAACCCAAAATATCCGGCCCAGAACCCACCCACAAAGGTGCCTGTGGGGAGAAAGGG
Full Trace Sequence: CCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGACGCCGGTGGTAACAGGGGAGGTTTCCGCGGGGGGTTCGGCGGTGGTGGCAGAGGCCGCGGTCGTGGAAGAGGCAGGGGACGAGGCAGAGGACGCGGGGCCCGTGGCGGGAAAGCTGACGACAAGGAATGGGTGCCAGTCACCAAGCTTGGACGTCTAGTCAAGGACATGAAGATCAAGTCTTTGGAGGAAATCTATCTCTTCTCCCTGCCAATCAAGGAGTCTGAGATCATCGACTTCTTCCTGGGCTCCACCCTGAAGGACGAGGTGTTGAAGATCATGCCTGTGCAGAAACAGACCCGTGCTGGACAGAGAACCAGGTTCAAGGCTTTTGTGGCTATTGGTGACTACAACGGTCACGTTGGTCTCGGTGTGAAATGCTCCAAAGAAGTGGCCACGGCCATCCGGGGAGCCATCATCCTGGCCAAACTGTCCATCGTTCCTGTTCGTAGAGGTTATTGGGGTAACAAGATCGGCAAGCCGCACACTGTGCCCTGCAAGGTTACTGGCCGCTGTGGTTCTGGCGGGGGTGCGTCTGATCCCAGCCCCCAGAGGTACTGGGTATTGTGTCTGCTCCCTGTCCCCAGAAGCTGCTCATGATGGCTGGTATTGATGACTGCTACACATCAGCCAGGGGCTGCACTGCTACCTTGGGAAACTCGCTAAAGCCACCTTTGATGCCATCTCAAAGACTTACAGCTATCTGACTCCTGATCTCTGGAGGGGGACGGTGGTTCTCCCAATTTCCCTCACCAGGAGTAACCCAAAATATCCGGCCCAGAACCCACCCACAAAGGTGCCTGTGGGGAGAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGACGCCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829947
dbEST ID: 79647649
Trimmed Sequence: GGAGGTGGCAGGAACAGCAGCAGCCTCAGTCCTCTGCACGGACACTCTGGTGTGAGTCTTGGCCAGATGATCTGTGTACTCCTGGTACGGAGATTTGGCGAACACAGTCTCCTTCCAGAGATCAGGAGTCAGATAGCTGTAAGTCTTTGAGATGGCATCAAAGGTGGCTTTAGCGAAGTTTCCCAAGGTAGCAGTGCAGCCCCTGGCTGATGTGTAGCAGTCATCAATACCAGCCATCATGAGCAGCTTCTTGGGGACAGGAGCAGACACAATACCAGTACCTCTGGGGGCTGGGATCAGACGCACCAGCACAGAACCACAGCGGCCAGTAACCTTGCAGGGCACAGTGTGCGGCTTGCCGATCTTGTTACCCCAATAACCTCTACGAACAGGAACGATGGACAGTTTGGCCAGGATGATGGCTCCCCGGATGGCCGTGGCCACTTCTTTGGAGCATTTCACACCGAGACCAACGTGACCGTTGTAGTCACCAATAGCCACAAAAGCCTTGAACCTGGTTCTCTGTCCAGCACGGGTCTGTTTCTGCACAGGCATGATCTTNCACACCTCGTCCTTCAGGGTGGAGCCCAGGAAGAAGTCGATGATCTCAGACTCCTTGATTGGCAGGGAGAAGAGATAGATTTCCCTCAAGACTTGATCTTCATGTCCTTGACTAGACGTTCCAACCTTGGGGAATGGGAACCCATTTCCTTTGTCGTTCAGCTTTTTCCCCCCCCGGGGCCCCCCGGCCCCCTCC
Full Trace Sequence: CCGTGAAACAGCTATGAACATGTAATACGACTCACTATAGGGGAAATCAGCTAGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGGTGGCAGGAACAGCAGCAGCCTCAGTCCTCTGCACGGACACTCTGGTGTGAGTCTTGGCCAGATGATCTGTGTACTCCTGGTACGGAGATTTGGCGAACACAGTCTCCTTCCAGAGATCAGGAGTCAGATAGCTGTAAGTCTTTGAGATGGCATCAAAGGTGGCTTTAGCGAAGTTTCCCAAGGTAGCAGTGCAGCCCCTGGCTGATGTGTAGCAGTCATCAATACCAGCCATCATGAGCAGCTTCTTGGGGACAGGAGCAGACACAATACCAGTACCTCTGGGGGCTGGGATCAGACGCACCAGCACAGAACCACAGCGGCCAGTAACCTTGCAGGGCACAGTGTGCGGCTTGCCGATCTTGTTACCCCAATAACCTCTACGAACAGGAACGATGGACAGTTTGGCCAGGATGATGGCTCCCCGGATGGCCGTGGCCACTTCTTTGGAGCATTTCACACCGAGACCAACGTGACCGTTGTAGTCACCAATAGCCACAAAAGCCTTGAACCTGGTTCTCTGTCCAGCACGGGTCTGTTTCTGCACAGGCATGATCTTNCACACCTCGTCCTTCAGGGTGGAGCCCAGGAAGAAGTCGATGATCTCAGACTCCTTGATTGGCAGGGAGAAGAGATAGATTTCCCTCAAGACTTGATCTTCATGTCCTTGACTAGACGTTCCAACCTTGGGGAATGGGAACCCATTTCCTTTGTCGTTCAGCTTTTTCCCCCCCCGGGGCCCCCCGGCCCCCTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGGTGGCAGGAACAG