ORFeome > rps2 ORF2 – XORFeome v1.0

rps2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rps2
Gene ID: 1003623
Gene Page ID: 1003615
ORF Xenbase ID: 17294589

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130122
Original XGC clone length: 1077

Human orthology & disease relationships

NCBI Entrez ID: 6187
Ensembl gene IDs: ENSG00000140988
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11090
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ838574
dbEST ID: 79656276
Trimmed Sequence: ATGAACTCTATGGATAGGCACATACAACAGACTAATGACCGTCTGCAGTGCATAAAACAGCACTTACAGAACCCTGCGAACTTTCACAATGCGGCTACAGAGCTTTTGGACTGGTGTGGTGATCCCCGAGCTTTCCAGAGACCTTTTGAGCAGAGTCTCATGGGCTGTTTGACGGTGGTTAGTCGAGTTGCAGCACAACAAGGTTTCGATCTGGACCTTGGATACAGGCTGCTAGCTGTATGTGCAGCCAACAGAGACAAGTTCACTCCCAAATCAGCAGCTCTACTCTCCTCTTGGTGTGAAGAATTGGGCAGGCTTCTCCTGCTACGCCACCAGAAGAACCGCCAGAACGATCCTCCAGGGAAACTCCCCATGCAGCCCCCCATGAACTCTTTGACCTCGATGAAACCCTCTCTTTCCCATGGCGATGGGTCTTTCCCTTATGACTCCATTCCTTGGCAACAGAACCCTACTCAGCCACCCGGTTCCCTGGTCTGTGGTCACTACTGTTTGGGGAGTAACAAACACCTCACAGAGCCAGGTCTTGAGAAACCCTATTGTGGATGCAAATAACCCCATGAATCCTGTAAGGCGAGCCCAAGGCAACAGGCAATGAACACAAAAAGTGCGGGGAATAATTTCCCCACAGTGTGCTGGAACAGCGGCAAGCAATTCCCTTCAAAAGGTTGTTTCTAGCCCAACCTCAGTGCCAGCAAAATTAAGTACGGGAACACCGCAGTAACGCGAGGAAGAGAGAGAGGGTTGGGGGGGGGGAGGGGTTGGGGGGGGGGCTCGCTAAACAGGCCCGTGTAAGAAAAGAGTAGATGAGTCTGCA
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACTCTATGGATAGGCACATACAACAGACTAATGACCGTCTGCAGTGCATAAAACAGCACTTACAGAACCCTGCGAACTTTCACAATGCGGCTACAGAGCTTTTGGACTGGTGTGGTGATCCCCGAGCTTTCCAGAGACCTTTTGAGCAGAGTCTCATGGGCTGTTTGACGGTGGTTAGTCGAGTTGCAGCACAACAAGGTTTCGATCTGGACCTTGGATACAGGCTGCTAGCTGTATGTGCAGCCAACAGAGACAAGTTCACTCCCAAATCAGCAGCTCTACTCTCCTCTTGGTGTGAAGAATTGGGCAGGCTTCTCCTGCTACGCCACCAGAAGAACCGCCAGAACGATCCTCCAGGGAAACTCCCCATGCAGCCCCCCATGAACTCTTTGACCTCGATGAAACCCTCTCTTTCCCATGGCGATGGGTCTTTCCCTTATGACTCCATTCCTTGGCAACAGAACCCTACTCAGCCACCCGGTTCCCTGGTCTGTGGTCACTACTGTTTGGGGAGTAACAAACACCTCACAGAGCCAGGTCTTGAGAAACCCTATTGTGGATGCAAATAACCCCATGAATCCTGTAAGGCGAGCCCAAGGCAACAGGCAATGAACACAAAAAGTGCGGGGAATAATTTCCCCACAGTGTGCTGGAACAGCGGCAAGCAATTCCCTTCAAAAGGTTGTTTCTAGCCCAACCTCAGTGCCAGCAAAATTAAGTACGGGAACACCGCAGTAACGCGAGGAAGAGAGAGAGGGTTGGGGGGGGGGAGGGGTTGGGGGGGGGGCTCGCTAAACAGGCCCGTGTAAGAAAAGAGTAGATGAGTCTGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTCTATGGATAGGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838573
dbEST ID: 79656275
Trimmed Sequence: GGAGGTGGCAGGAACAGCAGCAGCCTCAGTCCTCTGCACGGACACTCTGGTGTGAGTCTTGGCCAGATGATCTGTGTACTCCTGGTATGGAGATTTGGCGAACACAGTCTCCTTCCAGAGATCAGGAGTCAGATAGCTGTAAGTCTTTGAGATGGCATCAAAGGTGGCTTTAGCGAAGTTTCCCAAGGTAGCAGTGGCAGCAGCAGCAGCAACTGCAGCAGCGGCTGCAGCAGCTGCTGGCTGTGTGAAGTCTGCAGGTTGACGAGTGTGAGGGGGAATACCCATTCCTGAAGGATTGTTAGGGCCACCTGGATAGCTGCCACCAAACCCTCCTCCTCCTGGGTAATTGGGTCGTCCGTACATACTCTGCTGCATATAGGCTTGGCTAGAACCACCTTTTGAAGGAAACTGCTGCTGCTGTCCAGCAAACTGTGGAGAATTCATACCCGCACTATTGCTGTTCATGCCTGATGCCATGGGATTGCCTCCAGGATTCATTGGGTTATTTGCATTCACCATAGGGTTTCCCAAGACCTGGCTCTGTGAAGTGTTTGTTACTCCCCAAACATTAATGACCACAGACAGGGAACCCGGGTGGCTGACTAAGGGTTCTGTTTCCCAAGGAACCGAATTCCTAAGGAAAAAGAACCCATCCCATGGGAAAAAAGAGGGTTTTCACGAAAGGTCAAAGAATTTCTTGGGGGGGGCTGCATGGGGGAAGTTTTCCCGGGAAGAAATCTTCCTGGGGGGGTTCCTTTCTGGGGGGGCCTTAGCAAGG
Full Trace Sequence: AAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGGTGGCAGGAACAGCAGCAGCCTCAGTCCTCTGCACGGACACTCTGGTGTGAGTCTTGGCCAGATGATCTGTGTACTCCTGGTATGGAGATTTGGCGAACACAGTCTCCTTCCAGAGATCAGGAGTCAGATAGCTGTAAGTCTTTGAGATGGCATCAAAGGTGGCTTTAGCGAAGTTTCCCAAGGTAGCAGTGGCAGCAGCAGCAGCAACTGCAGCAGCGGCTGCAGCAGCTGCTGGCTGTGTGAAGTCTGCAGGTTGACGAGTGTGAGGGGGAATACCCATTCCTGAAGGATTGTTAGGGCCACCTGGATAGCTGCCACCAAACCCTCCTCCTCCTGGGTAATTGGGTCGTCCGTACATACTCTGCTGCATATAGGCTTGGCTAGAACCACCTTTTGAAGGAAACTGCTGCTGCTGTCCAGCAAACTGTGGAGAATTCATACCCGCACTATTGCTGTTCATGCCTGATGCCATGGGATTGCCTCCAGGATTCATTGGGTTATTTGCATTCACCATAGGGTTTCCCAAGACCTGGCTCTGTGAAGTGTTTGTTACTCCCCAAACATTAATGACCACAGACAGGGAACCCGGGTGGCTGACTAAGGGTTCTGTTTCCCAAGGAACCGAATTCCTAAGGAAAAAGAACCCATCCCATGGGAAAAAAGAGGGTTTTCACGAAAGGTCAAAGAATTTCTTGGGGGGGGCTGCATGGGGGAAGTTTTCCCGGGAAGAAATCTTCCTGGGGGGGTTCCTTTCTGGGGGGGCCTTAGCAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGGTGGCAGGAACAG