ORFeome > rps24 ORF1 – XORFeome v1.0

rps24 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rps24
Gene ID: 967651
Gene Page ID: 967644
ORF Xenbase ID: 17294607

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC053778
Original XGC clone length: 222

Human orthology & disease relationships

NCBI Entrez ID: 6229
Ensembl gene IDs: ENSG00000138326
Directly associated (OMIM) disease MIM numbers: 610629
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11001
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ839088
dbEST ID: 79656790
Trimmed Sequence: ATGACAAACAGACTTCTGCAGCGCAAGCAGATGGTCATTGATGTACTTCATCCAGGCAAAGCTACTGTCCCCAAGACTGAAATCAGAGAAAAGCTGGCAAAGATGTACAAGACAACCCCAGATGTTATTTTTGTGTTTGGTTTTAGGACTCACTTTGGAGGTGGCAAAACTACAGGCTTTGGCATGATCTACGACTCTCTTGACTATGCAAAAAAAGAATT
Full Trace Sequence: CCGGGGATCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAAACAGACTTCTGCAGCGCAAGCAGATGGTCATTGATGTACTTCATCCAGGCAAAGCTACTGTCCCCAAGACTGAAATCAGAGAAAAGCTGGCAAAGATGTACAAGACAACCCCAGATGTTATTTTTGTGTTTGGTTTTAGGACTCACTTTGGAGGTGGCAAAACTACAGGCTTTGGCATGATCTACGACTCTCTTGACTATGCAAAAAAAGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCAAAAAAAATCAAAAGTTACAAAAAACTTGGAATTGAAAAAGAAAAGAGAACAAATAACATGAACGCCTCTAAAACCACCCGGGGCACAATTGGCCTCTATCTGTTTTGCCGAGAAAAGGGTGCCCGGGAGAAAAAAAACCGGGGGAAAACGGATGAAGGGGATATAACAAAAAGGGAAAAAAAGCCCGGTCCCGGGTCCAAAACCTGGAAAGGAAAAAAACGGGGTGGGGCCTGCCGGGGGCCGGGGTCCGGAACCTTTTAACCAGAAATTTTTGGGGGGTTAAACCGGGCCCAGGGGGCCGCTTTTTCACGGGGCGGGGTAAACGAAGGGTGTTTTTTTTGGGGGGGTAGGGTACGAGGCCCCCCGGGGGCCACCCCAAGGCAGCCCCCCCCCCCCCCTACCCCCCCTGGGGTGGTAAGAAGATTTTGGGGGAGTGGGTTGGGGAGAACCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAAACAGACTTCTGCAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839087
dbEST ID: 79656789
Trimmed Sequence: TTCTTTTTTTGCATAGTCAAGAGAGTCGTAGATCATGCCAAAGCCTGTAGTTTTGCCACCTCCNAAGTGAGTCCTAAAACCAAACACAAAAATAACATCTGGGGTTGTCTTGTACATCTTTGCCAGCTTTTCTCTGATTTCAGTCTTGGGGACAGTAGCTTTGCCTGGATGAAGTACATCAATGACCATCTGCTTGCGCTGCAAAAGTCTGTTTGTCATGG
Full Trace Sequence: GAAAACGGCTAATGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTTTTTTTGCATAGTCAAGAGAGTCGTAGATCATGCCAAAGCCTGTAGTTTTGCCACCTCCNAAGTGAGTCCTAAAACCAAACACAAAAATAACATCTGGGGTTGTCTTGTACATCTTTGCCAGCTTTTCTCTGATTTCAGTCTTGGGGACAGTAGCTTTGCCTGGATGAAGTACATCAATGACCATCTGCTTGCGCTGCAAAAGTCTGTTTGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAACTGTACCGTCAGAAAAAAAGAAAGAAAAAGTTATGCTGGCGTAGGGAAGCGCGAGGGGGAGAGAAGACGAAAAGGTCCCGCGGGCACCGGGGGCGGCGGGGGCTCTCTTGGTGGGGGGTGAAAAGAGGGAACATAAGGAAAAAAACACGGGGGGTGTGTGGAAGTGTTGAAACAGGGAGAGCCAACCCCCCCCGGGGCGGAAAATTGAGGGAGAGAAAAGGGGGGGGGGGGGGGGGGGGGTGTCTGATATTGTTTAATTATTTTTTTGGGGGGGGACAACCCCCCTGGCGGCGGGAAACCCCGCGGGTTCGCGCCGGGCTGTGTTTGTGGGTGGGTGATTCCGCGACGGGCCGCTCACCCCACCCGCCGCCCGCGGCCGCGAGGCGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGAGAGGGGACCCTCTAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTTTTTTTGCATAGTCAAGAG