ORFeome > rps27 ORF1 – XORFeome v1.0

rps27 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rps27
Gene ID: 6253776
Gene Page ID: 5953675
ORF Xenbase ID: 17294619

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053815
Original XGC clone length: 255

Human orthology & disease relationships

NCBI Entrez ID: 6232
Ensembl gene IDs: ENSG00000177954
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11001
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ839227
dbEST ID: 79656929
Trimmed Sequence: ATGCCACTCGCTAAGGATCTCCTGCACCCAACTCCCGAGGAGGAGAAGAGGAAACACAAGAAGAAGCGCCTGGTCCAGAGCCCAAACTCCTATTTCATGGATGTCAAATGCCCAGGTTGTTACAAGATCACCACAGTGTTCAGTCACGCGCAAACTGTCGTCCTGTGTGTCGGCTGCTCCACTGTCCTGTGTCAGCCCACGGGGGGCAAAGCTCGGCTCACAGAAGGTTGTTCCTTCAGAAGAAAGCAACACTT
Full Trace Sequence: GGGGGCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCACTCGCTAAGGATCTCCTGCACCCAACTCCCGAGGAGGAGAAGAGGAAACACAAGAAGAAGCGCCTGGTCCAGAGCCCAAACTCCTATTTCATGGATGTCAAATGCCCAGGTTGTTACAAGATCACCACAGTGTTCAGTCACGCGCAAACTGTCGTCCTGTGTGTCGGCTGCTCCACTGTCCTGTGTCAGCCCACGGGGGGCAAAGCTCGGCTCACAGAAGGTTGTTCCTTCAGAAGAAAGCAACACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTATAAAAACTCAAAGGTAACAAACCTCGCCTTTCGAAACGGCCGAGAAACAAAGGAAAAAATGGCCCGCCCCAAAACGGGGCCGGGGAAATATTCGTTGGTAATGGGGGGAAGCCCTAAAGCAGGGGGGATAAACCCCGTGGGGGGGAAACGGGGGTAGGGAGAAAAAGGCCGGGGGGAGCTCCTGGCGCAAAAAATTGAAAAAAACAAAAAGGGGATGAAGGCGGGGGGGGGGTCTTTTGGGTGTTTTAAAAAGTTTTTTTGAGGAGGGTATCTGGGGGTGAGCCGCGCCCCAAGGGGGATTTTTATCGGGTGGTGTTTTGTTTTGTGTTTTTTTGGTGGGGGAAAACGGTATACACCCCCGCCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACTCGCTAAGGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ839226
dbEST ID: 79656928
Trimmed Sequence: GTGTTGCTTTCTTCTGAAGGAACAACCTTCTGTGAGCCGAGCTTTGCCCCCCGTGGGCTGACACAGGACAGTGGAGCAGCCGACACACAGGACGACAGTTTGCGCGTGACTGAACACTGTGGTGATCTTGTAACAACCTGGGCATTTGACATCCATGAAATAGGAGTTTGGGCTCTGGACCAGGCGCTTCTTCTTGTGTTTCCTCTTCTCCTCCTCGGGAGTTGGGTGCAGGAGATCCTTAGCGAGTGGCATGG
Full Trace Sequence: GCGGAATCAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGTTGCTTTCTTCTGAAGGAACAACCTTCTGTGAGCCGAGCTTTGCCCCCCGTGGGCTGACACAGGACAGTGGAGCAGCCGACACACAGGACGACAGTTTGCGCGTGACTGAACACTGTGGTGATCTTGTAACAACCTGGGCATTTGACATCCATGAAATAGGAGTTTGGGCTCTGGACCAGGCGCTTCTTCTTGTGTTTCCTCTTCTCCTCCTCGGGAGTTGGGTGCAGGAGATCCTTAGCGAGTGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGCCGACAAAATAAAACATCATAACAGATATATACGGCGTCTGCAAAAACCACGCGGCACAAAAAGAAAAAGCCCNCTCTCAAAAGAGGGGCGGGGTGGTAATACTTGGTATTGGGGGGACACGCACACGGCACGAAACTTTCCGGGTGTGGGTGAGGGGGGGGGGGGACCCGCGGGGGGGGCGGCCCCGCGCGGCAAAAAAAATTAAAAAAGGGGGGGAGAGGAGCCGGGGGTGGTGGTGTTTTTGTTATATTTTNTTGTTGTTTGTTTTTTTTTCAACCCCCACCGCACCCGCCCGAGACCGCGCGCACGGGCCGGAGGTTTTTGGTNGTNGAAAGGATGGGAGGAGAANGCAAANGGAAAACGCACACGCCCACCGCGGAAGAACAAGGGTGTAAGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGTTGCTTTCTTCTGAAGG