ORFeome > rps28p9 ORF2 – XORFeome v1.0

rps28p9 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rps28p9
Gene ID: 1006620
Gene Page ID: 1006613
ORF Xenbase ID: 17294637

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099294
Original XGC clone length: 210

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ840162
dbEST ID: 79657864
Trimmed Sequence: ATGGAAGCCAGCCGCGTGCAGCCGATCAAGCTTGCCCGGGTAACAAAAGTCTTGGGGCGCACTGGTTCTCAGGGTCAGTGTACCCAGGTCCGTGTCGAGTTCATGGATGACAGCAACCGTTCCATCATCCGTAATGTTAAGGGACCAGTTAGAGAGGGTGATGTCCTGACTCTGCTGGAATCTGAGCGAGAAGCTAGGAGATTACGTTT
Full Trace Sequence: GGGGGCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGCCAGCCGCGTGCAGCCGATCAAGCTTGCCCGGGTAACAAAAGTCTTGGGGCGCACTGGTTCTCAGGGTCAGTGTACCCAGGTCCGTGTCGAGTTCATGGATGACAGCAACCGTTCCATCATCCGTAATGTTAAGGGACCAGTTAGAGAGGGTGATGTCCTGACTCTGCTGGAATCTGAGCGAGAAGCTAGGAGATTACGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTAACAAAATAACAGAAAATACATCCCCCGGCAAAAGCAAGACAGGGAAGAAAAAATGCAGGGGCTTCCAGAAAACCCGGGACCAAGTTGGCCCGGTCTTTGTTAACAAAAAAAGGTCGAAGGGAAAAAAAACAAAGGGGAAGGGGTTGGAAGGTTTAAACCAAGGGCGAAAGCGGGCCGGCTCCGGGGCCAAAACTTTTAAGAAAAGTAGGGGTTGGAGCGGCGGGAGGGGGGGTTTAAAGGCTTTGAAAGAAAGTTTTTTGGGGGAACAAGCCGCCCCGGGGGGGGTTCCCCACGGGAGGGGGTTAACCGGGGGTTTTTTGGGGGAAGGAGTTTAAAGAACCCGGGGGGCACCCCAAAACAAGAAACCCCCCCCCCACCCCCCCGGGGGTGTCTAAAATGTGGGTGGGGGGGGGTGTTCGGGGCCACCCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGCCAGCCGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ840161
dbEST ID: 79657863
Trimmed Sequence: ACGTAATCTCCTAGCTTCTCGCTCAGATTCCAGCAGAGTCAGGACATCACCCTCTCTAACTGGTCCCTTAACATTACGGATGATGGAACGGTTGCTGTCATCCATGAACTCGACACGGACCTGGGTACACTGACCCTGAGAACCAGTGCGCCCCAAGACTTTTGTTACCCGGGCAAGCTTGATCGGCTGCACGCGGCTGGCTTCCATGG
Full Trace Sequence: GCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTNCNNCAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAANTTGGCAAACGTAATCTCCTAGCTTCTCGCTCAGATTCCAGCAGAGTCAGGACATCACCCTCTCTAACTGGTCCCTTAACATTACGGATGATGGAACGGTTGCTGTCATCCATGAACTCGACACGGACCTGGGTACACTGACCCTGAGAACCAGTGCGCCCCAAGACTTTTGTTACCCGGGCAAGCTTGATCGGCTGCACGCGGCTGGCTTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCGACCTTAATACTGGCCGTCAATTCACAACGTATAGACTGAGCTGTTTCCTGACAGCTCTCGCCCGTATCTCAAGTCTCAGATCTTGCAACCCGGGGGCTTCCGGTTATCTGTTGTGGGTCAGCGGGAATCGCTGGACATTGCAAACCACGGGGATCGGTTCGGAGGCTGTCAGCCAAGGGGCAAGACGACCCCCGGCGGGGACAAAATCTTGCCGAAGGGTAACGGAGGGCCCGGGGGAGGGGGGGGTTCATAGGCTTTAACAGAAGTTTTTTGTGGGGAGANTCTGAGGGCGGGGCGCCTCAAAAGGCGGGGGCCTTAGCGCGGGGGTGTTGGTGTGGGTGGTGTGGAGTTCACCAGGGTGTACCACACCGAGGGGGGCCCTNTTCCACCNGNGTGACCACATTGNGGAGGGGGGGGTGTAGGGCAAGAAAACAGCGCCCNCTCTCNAAAAGGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGTAATCTCCTAGCTTCTC