ORFeome > rps6 ORF1 – XORFeome v1.0

rps6 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rps6
Gene ID: 1003294
Gene Page ID: 1003286
ORF Xenbase ID: 17294673

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054151
Original XGC clone length: 750

Human orthology & disease relationships

NCBI Entrez ID: 6194
Ensembl gene IDs: ENSG00000137154
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11001
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ839168
dbEST ID: 79656870
Trimmed Sequence: ATGAAGCTTAATATCTCGTTCCCAGCCACTGGCTGCCAAAAGCTCATTGAAGTGGAGGATGAGCGCAAGCTGCGTACTTTCTATGAGAAGCGCATGGCCACAGAGGTCGCCGCAGATCCCTTGGGTGATGAGTGGAAGGGATATGTTGTTCGCATCAGCGGTGGAAACGATAAGCAAGGCTTCCCCATGAAACAGGGAGTCCTAACTCATGGTCGTGTTCGTCTTCTATTAAGCAAGGGTCATTCCTGCTATCGCCCCAGGAGAACTGGTGAACGCAAGCGCAAATCTGTACGTGGATGTATTGTGGATGCTAACCTCAGTGTCCTGAACTTGGTTATTGTTAGGAAAGGTGAAAAGGATATTCCTGGCCTGACAGACAACACTGTTCCTCGTCGCCTGGGTCCCAAAAGAGCCAGCAGAATCCGCAAACTATTCAACTTGTCCAAAGAAGATGATGTGCGTCAGTATGTAGTGAGAAAGCCTCTGGCTAAGGAAGGGAAAAAGCCCAGGACCAAGGCCCCTAANATCCAGCGTCTAGTGACCCCCAGAGTTCTACAGCATAAGCGCAGACGTATTGCTTTGAAGAAGCAGCGTACTCAGAAGAATAAAGAAGAGGCTTCAGAGTATGCCAAACTTCTGGCTAAGAGATCAAAAGAAGCCAAGGAAAAACGCCCGGAGCAGATCGCAAAAAAGCGTAGACTGCCTCCTTTGAAACCCTCACATCCCAATCCTAAACCCAGTCAAAAATTTGCCAACGTTCTTGGTACAATGTTGGGGG
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGCTTAATATCTCGTTCCCAGCCACTGGCTGCCAAAAGCTCATTGAAGTGGAGGATGAGCGCAAGCTGCGTACTTTCTATGAGAAGCGCATGGCCACAGAGGTCGCCGCAGATCCCTTGGGTGATGAGTGGAAGGGATATGTTGTTCGCATCAGCGGTGGAAACGATAAGCAAGGCTTCCCCATGAAACAGGGAGTCCTAACTCATGGTCGTGTTCGTCTTCTATTAAGCAAGGGTCATTCCTGCTATCGCCCCAGGAGAACTGGTGAACGCAAGCGCAAATCTGTACGTGGATGTATTGTGGATGCTAACCTCAGTGTCCTGAACTTGGTTATTGTTAGGAAAGGTGAAAAGGATATTCCTGGCCTGACAGACAACACTGTTCCTCGTCGCCTGGGTCCCAAAAGAGCCAGCAGAATCCGCAAACTATTCAACTTGTCCAAAGAAGATGATGTGCGTCAGTATGTAGTGAGAAAGCCTCTGGCTAAGGAAGGGAAAAAGCCCAGGACCAAGGCCCCTAANATCCAGCGTCTAGTGACCCCCAGAGTTCTACAGCATAAGCGCAGACGTATTGCTTTGAAGAAGCAGCGTACTCAGAAGAATAAAGAAGAGGCTTCAGAGTATGCCAAACTTCTGGCTAAGAGATCAAAAGAAGCCAAGGAAAAACGCCCGGAGCAGATCGCAAAAAAGCGTAGACTGCCTCCTTTGAAACCCTCACATCCCAATCCTAAACCCAGTCAAAAATTTGCCAACGTTCTTGGTACAATGTTGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCTTAATATCTCGTTCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ839167
dbEST ID: 79656869
Trimmed Sequence: TTTCTGACTGGATTCAGATTTGGATGTGGAGGCTCTCAAAGAAGACAGTCTACGCCTCTTTGCGATCTGCTCCTGGCGTTTTTCCTTGGCTTCCTTTGATCTCTTAGCCAGAAGTTTGGCATATTCTGAAGCCTCTTCCTTATTCTTTTGAGTACGCTGCTTCTTCAAAGCAATACGTCTGCGCTTATGCTGTAGAACTCTGGGGGTCACTAGACGCTGGATTTTAGGGGCCTTGGTCCTGGGCTTTTTCCCTTCCTTAGCCAGAGGCTTTCTCACTACATACTGACGCACATCATCTTCTTTGGACAAGTTGAATAGTTTGCGGATTCTGCTGGCTCTTTTGGGACCCAGGCGACGAGGAACAGTGTTGTCTGTCAGGCCAGGAATATCCTTTTCACCTTTCCTAACAATAACCAAGTTCAGGACACTGAGGTTAGCATCCACAATACATCCACGTACAGATTTGCGCTTGCGTTCACCAGTTCTCCTGGGGCGATAGCAGGAATGACCCTTGGTTAATAGAAGACGAACACGACCCTGAATTAGGACTCCCTGTTTCATGGGGGACCGTTGCTTATCGGTTCCACCGCTGATGGGAACAACATATCCCTTCCACTCATCACCCCAAGGATCTGCCGGCGACCTCCGGGGGCATGGCCCTTCTCAAAAAAAGTACGCCGCCTTGCCGCTCCCCCCCCCTTTTATTGAGCCTTTTGGGCGACAGTGGGCTGGGGAAAAGAAAAATTTAAAGCCTTCTGGGGGGGCCCAC
Full Trace Sequence: GGAGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTGACTGGATTCAGATTTGGATGTGGAGGCTCTCAAAGAAGACAGTCTACGCCTCTTTGCGATCTGCTCCTGGCGTTTTTCCTTGGCTTCCTTTGATCTCTTAGCCAGAAGTTTGGCATATTCTGAAGCCTCTTCCTTATTCTTTTGAGTACGCTGCTTCTTCAAAGCAATACGTCTGCGCTTATGCTGTAGAACTCTGGGGGTCACTAGACGCTGGATTTTAGGGGCCTTGGTCCTGGGCTTTTTCCCTTCCTTAGCCAGAGGCTTTCTCACTACATACTGACGCACATCATCTTCTTTGGACAAGTTGAATAGTTTGCGGATTCTGCTGGCTCTTTTGGGACCCAGGCGACGAGGAACAGTGTTGTCTGTCAGGCCAGGAATATCCTTTTCACCTTTCCTAACAATAACCAAGTTCAGGACACTGAGGTTAGCATCCACAATACATCCACGTACAGATTTGCGCTTGCGTTCACCAGTTCTCCTGGGGCGATAGCAGGAATGACCCTTGGTTAATAGAAGACGAACACGACCCTGAATTAGGACTCCCTGTTTCATGGGGGACCGTTGCTTATCGGTTCCACCGCTGATGGGAACAACATATCCCTTCCACTCATCACCCCAAGGATCTGCCGGCGACCTCCGGGGGCATGGCCCTTCTCAAAAAAAGTACGCCGCCTTGCCGCTCCCCCCCCCTTTTATTGAGCCTTTTGGGCGACAGTGGGCTGGGGAAAAGAAAAATTTAAAGCCTTCTGGGGGGGCCCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTGACTGGATTCAGATTTGG