ORFeome > rps6ka4 ORF1 – XORFeome v1.0

rps6ka4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rps6ka4
Gene ID: 5759520
Gene Page ID: 5759515
ORF Xenbase ID: 17294697

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124881
Original XGC clone length: 2298

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ838823
dbEST ID: 79656525
Trimmed Sequence: ATGGGGGATCCGGACAGGAGAGAGACCCGCAGCCCGATCCATGTGAATCTGACTGGAAATGAGGAAAGAGTTGCCATGAAAGACTTTGAGCTACTGAAGATCTTGGGAACTGGAGCGTATGGAAAGGTATTCCTTGTACGGAAGGTGACTGGGCCAGATACCAACCATCTCTATGCTATGAAAGTCCTCCAAAAATGTGCACTAGTAAAAAAGGAAAAGACCGTGGAGCATACGAAAACGGAGCGCAATGTACTCGAACATGTGAGGGAAAGCCCTTTCCTAGTAACACTTCACTATGCCTTCCAGACAGAGGCCAAGCTCCATCTTATACTGGATTATGTGAGTGGCGGAGAGCTTTTCACTCACCTCTATCAGCGAGATAATTTCTCTGAAGATGCAGTGCGGTTTTACTCCGGAGAGGTTATTTTGGCCCTGGAGCATTTGCACAAGTTGGGCGTTGTGTACAGGGACATTAAGCTGGAGAACATCCTGTTGGATAGCGAGGGCCATGTGGTGCTGACAGACTTTGGCCTGAGCAAAGAGTTCCTATCTGAAGAGGAGGAGCGCACATATTCATTCTGTGGGAAAACAAAGTACTTGGGCACCAGAAATTATACGAAGAAAGGGAGGCCATGGCAAGAATTGTAACTTGGTGGAGCTTGGGAATCCCTGACCATTAATTTCTTTCAGGAGCATCTTCTTTCCCCTTGGAGGGAAAAAAAAACCAAAAAATTAAATTTTCAAGGCTTTATCCTGAACATGGAACCCCTCTCTTTCCGTCCTTTTCTCGAATTTTCTCGGGGCCCAAAAATCTT
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGGATCCGGACAGGAGAGAGACCCGCAGCCCGATCCATGTGAATCTGACTGGAAATGAGGAAAGAGTTGCCATGAAAGACTTTGAGCTACTGAAGATCTTGGGAACTGGAGCGTATGGAAAGGTATTCCTTGTACGGAAGGTGACTGGGCCAGATACCAACCATCTCTATGCTATGAAAGTCCTCCAAAAATGTGCACTAGTAAAAAAGGAAAAGACCGTGGAGCATACGAAAACGGAGCGCAATGTACTCGAACATGTGAGGGAAAGCCCTTTCCTAGTAACACTTCACTATGCCTTCCAGACAGAGGCCAAGCTCCATCTTATACTGGATTATGTGAGTGGCGGAGAGCTTTTCACTCACCTCTATCAGCGAGATAATTTCTCTGAAGATGCAGTGCGGTTTTACTCCGGAGAGGTTATTTTGGCCCTGGAGCATTTGCACAAGTTGGGCGTTGTGTACAGGGACATTAAGCTGGAGAACATCCTGTTGGATAGCGAGGGCCATGTGGTGCTGACAGACTTTGGCCTGAGCAAAGAGTTCCTATCTGAAGAGGAGGAGCGCACATATTCATTCTGTGGGAAAACAAAGTACTTGGGCACCAGAAATTATACGAAGAAAGGGAGGCCATGGCAAGAATTGTAACTTGGTGGAGCTTGGGAATCCCTGACCATTAATTTCTTTCAGGAGCATCTTCTTTCCCCTTGGAGGGAAAAAAAAACCAAAAAATTAAATTTTCAAGGCTTTATCCTGAACATGGAACCCCTCTCTTTCCGTCCTTTTCTCGAATTTTCTCGGGGCCCAAAAATCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGGATCCGGACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838822
dbEST ID: 79656524
Trimmed Sequence: AGAGTGTCCAGAACAATGACTCTGAGGGGTGCCCTTGGATTTTGGAGAATAGGATGCAGATGCGGCAGCTGATGATGAGGAAGAAGAGGATGAGGAGGAACCACTGCGTGTGTCACCACCAGTACTGCACATCTTCAGCTTGCGTCTCTTGGCAAGGGGAGCATTATCCACGCTCTTTAGGAATACACCCTCTCGCTTTCCACGGTTAAAGGCCATGAAGGTGGCATCCACACAGTTCTTAGTGGCTAGGCCACTAGATTCCAAGACATCTGGAGTCATTAGAGGAGTGGAGGAGAGAGGACGCCCACCACGAAGCCAATCACTTTCCTGGAGTTCATTCAGACTCAGTCTGCAAGTGGGGTCCACGATCAAAAGGCCTCTGACCAGATCCTTGGCCTCTTCACTCACATGCTCCCAACATTTGCCCTCCATGCTAAAATCGCCTTCCTTAATCTTCTGTATGATGTCAGCTGCACGGTTATGAAATTTGCCTCTTTTCACTTGGAAGGGCACCTGACCAGACAGCATGGTATACAGAATGACTCCAAGAGTCCACAGGTCACACAGTTCGTCATATCCCTGGTTAGAAGATAGTTCTGGAGCAGCATAATGAGGGGTGAAGCAGGGAGTGTGGTATGGACGTGATCCTGGGTGGGCGAAGTCTTGCAAATCCAAAATCAATGACTTTTTAGTACTGCGTTCTCCCCAAGGAAAAGAACAAAAAAAGAATTCTCCTGGCCTTTAGGGTCCCCGGTGTTTCCGAACTCCCGG
Full Trace Sequence: AACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAGTGTCCAGAACAATGACTCTGAGGGGTGCCCTTGGATTTTGGAGAATAGGATGCAGATGCGGCAGCTGATGATGAGGAAGAAGAGGATGAGGAGGAACCACTGCGTGTGTCACCACCAGTACTGCACATCTTCAGCTTGCGTCTCTTGGCAAGGGGAGCATTATCCACGCTCTTTAGGAATACACCCTCTCGCTTTCCACGGTTAAAGGCCATGAAGGTGGCATCCACACAGTTCTTAGTGGCTAGGCCACTAGATTCCAAGACATCTGGAGTCATTAGAGGAGTGGAGGAGAGAGGACGCCCACCACGAAGCCAATCACTTTCCTGGAGTTCATTCAGACTCAGTCTGCAAGTGGGGTCCACGATCAAAAGGCCTCTGACCAGATCCTTGGCCTCTTCACTCACATGCTCCCAACATTTGCCCTCCATGCTAAAATCGCCTTCCTTAATCTTCTGTATGATGTCAGCTGCACGGTTATGAAATTTGCCTCTTTTCACTTGGAAGGGCACCTGACCAGACAGCATGGTATACAGAATGACTCCAAGAGTCCACAGGTCACACAGTTCGTCATATCCCTGGTTAGAAGATAGTTCTGGAGCAGCATAATGAGGGGTGAAGCAGGGAGTGTGGTATGGACGTGATCCTGGGTGGGCGAAGTCTTGCAAATCCAAAATCAATGACTTTTTAGTACTGCGTTCTCCCCAAGGAAAAGAACAAAAAAAGAATTCTCCTGGCCTTTAGGGTCCCCGGTGTTTCCGAACTCCCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGTGTCCAGAACAATGACT