ORFeome > rps8 ORF1 – XORFeome v1.0

rps8 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rps8
Gene ID: 5935325
Gene Page ID: 5934817
ORF Xenbase ID: 17294733

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054266
Original XGC clone length: 627

Human orthology & disease relationships

NCBI Entrez ID: 6202
Ensembl gene IDs: ENSG00000142937
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219500,400042,603896

Library Location

Plate ID: GDExl11001
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ839208
dbEST ID: 79656910
Trimmed Sequence: ATGGGTATCTCAAGGGACAACTGGCACAAGCGCCGCAAGACTGGAGGCAAAAGGAAGCCATACCACAAAAAGAGAAAGTATGAACCTGGCCGTCCTGCCGCTAACACCAAGATCGGTCCTCGCCGTATCCACACTGTGAGAGTCCGTGGTGGTAACAAAAAGTATCGTGCTCTGAGGTTGGATGCTGGCAATTTTTCATGGGGCTCAGAGTGTTGCACACGTAAAACTAGAATCATCGATGTGGTGTACAATGCTTCTAACAATGAGCTGGTTCGAACCAAAACCCTTGTGAAGAACTGCATTCTCCTGGTTGACAGCACTCCTTTCAGACAGTGGTTTGAGGCCCACTATGCTTTGCCACTAGGACGCAAGAAGGGAGCCAAACTTACCCCCGAAGAGGAAGAAATCCTGAACAAGAAACGATCCAAGAAAACGCAGAAGAAATATGAGGAGAGGAAAAAGACCGCAAAAATAAGCCCACTTTTGGAAGAACAGTTCCAGCAAGGCAAACTGCTTGCATGCATAGCATCCAGACCAGGTCAATGTGGTAGAGCTGATGGTTATGTACTGGAAGGGAAGGAGTTGGAGTTCTACCTGAAAAAGATCAAGGCTAAAAAGGGCAAATT
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTATCTCAAGGGACAACTGGCACAAGCGCCGCAAGACTGGAGGCAAAAGGAAGCCATACCACAAAAAGAGAAAGTATGAACCTGGCCGTCCTGCCGCTAACACCAAGATCGGTCCTCGCCGTATCCACACTGTGAGAGTCCGTGGTGGTAACAAAAAGTATCGTGCTCTGAGGTTGGATGCTGGCAATTTTTCATGGGGCTCAGAGTGTTGCACACGTAAAACTAGAATCATCGATGTGGTGTACAATGCTTCTAACAATGAGCTGGTTCGAACCAAAACCCTTGTGAAGAACTGCATTCTCCTGGTTGACAGCACTCCTTTCAGACAGTGGTTTGAGGCCCACTATGCTTTGCCACTAGGACGCAAGAAGGGAGCCAAACTTACCCCCGAAGAGGAAGAAATCCTGAACAAGAAACGATCCAAGAAAACGCAGAAGAAATATGAGGAGAGGAAAAAGACCGCAAAAATAAGCCCACTTTTGGAAGAACAGTTCCAGCAAGGCAAACTGCTTGCATGCATAGCATCCAGACCAGGTCAATGTGGTAGAGCTGATGGTTATGTACTGGAAGGGAAGGAGTTGGAGTTCTACCTGAAAAAGATCAAGGCTAAAAAGGGCAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATTAATTCAAATAAAATCATTATTTGCCCTCCAGCCTAAAAACCCCAATAGGGAAGTCTAATACATGGGTCAAAAAAAAATAACCAGGGAAGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTATCTCAAGGGACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839207
dbEST ID: 79656909
Trimmed Sequence: TTTGCCCTTTTTAGCCTTGATCTTTCTCAGGTAGAACTCCAACTCCTTCCCTTCCAGTACATAACCATCAGCTCTACCACATTGACCTGGTCTGGATGCTATGCATGCAAGCAGTTTGCCTTGCTGGAACTGTTCTTCCAAAAGTGGGCTTATTTTTGCGGTCTTTTTCCTCTCCTCATATTTCTTCTGCGTTTTCTTGGATCGTTTCTTGTTCAGGATTTCTTCCTCTTCGGGGGTAAGTTTGGCTCCCTTCTTGCGTCCTAGTGGCAAAGCATAGTGGGCCTCAAACCACTGTCTGAAAGGAGTGCTGTCAACCAGGAGAATGCAGTTCTTCACAAGGGTTTTGGTTCGAACCAGCTCATTGTTAGAAGCATTGTACACCACATCGATGATTCTAGTTTTACGTGTGCAACACTCTGAGCCCCATGAAAAATTGCCAGCATCCAACCTCAGAGCACGATACTTTTTGTTACCACCACGGACTCTCACAGTGTGGATACGGCGAGGACCGATCTTGGTGTTAGCGGCAGGACGGCCAGGTTCATACTTTCTCTTTTTGTGGTATGGCTTCCTTTTGCCTCCAGTCCTGCGGCGCCTGGGCCAGTTGGTCCCTGAGATACCCATGG
Full Trace Sequence: CCGAGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGCCCTTTTTAGCCTTGATCTTTCTCAGGTAGAACTCCAACTCCTTCCCTTCCAGTACATAACCATCAGCTCTACCACATTGACCTGGTCTGGATGCTATGCATGCAAGCAGTTTGCCTTGCTGGAACTGTTCTTCCAAAAGTGGGCTTATTTTTGCGGTCTTTTTCCTCTCCTCATATTTCTTCTGCGTTTTCTTGGATCGTTTCTTGTTCAGGATTTCTTCCTCTTCGGGGGTAAGTTTGGCTCCCTTCTTGCGTCCTAGTGGCAAAGCATAGTGGGCCTCAAACCACTGTCTGAAAGGAGTGCTGTCAACCAGGAGAATGCAGTTCTTCACAAGGGTTTTGGTTCGAACCAGCTCATTGTTAGAAGCATTGTACACCACATCGATGATTCTAGTTTTACGTGTGCAACACTCTGAGCCCCATGAAAAATTGCCAGCATCCAACCTCAGAGCACGATACTTTTTGTTACCACCACGGACTCTCACAGTGTGGATACGGCGAGGACCGATCTTGGTGTTAGCGGCAGGACGGCCAGGTTCATACTTTCTCTTTTTGTGGTATGGCTTCCTTTTGCCTCCAGTCCTGCGGCGCCTGGGCCAGTTGGTCCCTGAGATACCCATGGTGCCAACTTTTTTTGAACAAAGTTGGCATTAAAAAAAAAACATTGCCTCACCAAATTTGGTGCAACAAAAAGGTCACCTAATTAATCAAAAAAAAAAATCCATTTATTGGGGGGCCCGAAGCCTTGAAAAAGGGGGCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGCCCTTTTTAGCCTTGATCTT