ORFeome > rpsa ORF1 – XORFeome v1.0

rpsa ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rpsa
Gene ID: 972241
Gene Page ID: 972234
ORF Xenbase ID: 17294745

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046271
Original XGC clone length: 921

Human orthology & disease relationships

NCBI Entrez ID: 3921
Ensembl gene IDs: ENSG00000168028
Directly associated (OMIM) disease MIM numbers: 271400
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,123400,137440,180105,219500,245300,400042,600072,603218,603896,606688,608688

Library Location

Plate ID: GDExl11017
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ824386
dbEST ID: 79642088
Trimmed Sequence: ATGTCCGGAGGTCTTGATGTCCTGCAGATGAAGGAGGAAGATGTCCTCAAGTTCCTGGCAGCAGGGACCCACTTGGGTGGCACCAATCTTGACTTCCAGATGGAGCAGTATATCTATAAAAGGAAGAGTGATGGCATCTACATAATTAACCTGAAACGCACCTGGGAAAAGCTTTTGCTTGCTGCTCGTGCCATTGTAGCAATTGAAAATCCTGCTGATGTGTGTGTCATTTCTTCAAGGAACACTGGACAGCGAGCTGTACTGAAATTTGCTTCTGCCAGTGGTGCCACACCTATTGCTGGTCGCTTCACTCCCGGTACCTTCACCAACCAGATCCAGGCTGCTTTTCGGGAGCCTCGGCTGCTGGTGGTGACAGATCCCCGGGCAGATCACCAACCCCTTACTGAGGCTTCATACGTCAACATTCCTACCATTGCCTTGTGTAATACAGATTCACCATTGCGCTATGTGGATATAGCTATCCCATGTAACAATAAGGGTGCTCATTCTGTTGGTCTAATGGTGGTGGATGTTGGNCTCGTGAGGTTCTGCGCATGAGAGGAACAATCTCTCGTGAGCACCCTTGGGAAGTTATGCCCGATCTGTACTTCTACCGTGATCCAGAAGAAATTGAGAAGGAGGAGCAGGCAGCTGCAGAGAAAGCCACAACCAAGAAGATTCCNAGGAGAATGGACTGCACCTGTGGCAGATTCCTTCAGGCTGAAGTGCTAATGGGGCTGAAAGTGTACAGGGTCCATCTGTTCCCTCCCGGCCTTTTCCACTGGAAACTCCCAATGTTCCAACCCCCCC
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGGAGGTCTTGATGTCCTGCAGATGAAGGAGGAAGATGTCCTCAAGTTCCTGGCAGCAGGGACCCACTTGGGTGGCACCAATCTTGACTTCCAGATGGAGCAGTATATCTATAAAAGGAAGAGTGATGGCATCTACATAATTAACCTGAAACGCACCTGGGAAAAGCTTTTGCTTGCTGCTCGTGCCATTGTAGCAATTGAAAATCCTGCTGATGTGTGTGTCATTTCTTCAAGGAACACTGGACAGCGAGCTGTACTGAAATTTGCTTCTGCCAGTGGTGCCACACCTATTGCTGGTCGCTTCACTCCCGGTACCTTCACCAACCAGATCCAGGCTGCTTTTCGGGAGCCTCGGCTGCTGGTGGTGACAGATCCCCGGGCAGATCACCAACCCCTTACTGAGGCTTCATACGTCAACATTCCTACCATTGCCTTGTGTAATACAGATTCACCATTGCGCTATGTGGATATAGCTATCCCATGTAACAATAAGGGTGCTCATTCTGTTGGTCTAATGGTGGTGGATGTTGGNCTCGTGAGGTTCTGCGCATGAGAGGAACAATCTCTCGTGAGCACCCTTGGGAAGTTATGCCCGATCTGTACTTCTACCGTGATCCAGAAGAAATTGAGAAGGAGGAGCAGGCAGCTGCAGAGAAAGCCACAACCAAGAAGATTCCNAGGAGAATGGACTGCACCTGTGGCAGATTCCTTCAGGCTGAAGTGCTAATGGGGCTGAAAGTGTACAGGGTCCATCTGTTCCCTCCCGGCCTTTTCCACTGGAAACTCCCAATGTTCCAACCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGGAGGTCTTGATGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829745
dbEST ID: 79647447
Trimmed Sequence: AGACCATTCAGTAGTAGTTCCAGTCCATTCTGATGCTTGAGCAGTAGGGGCAGCAGACCAGTCATCAGTGCTTGCAGGCTGAGCACTCCAATCTTCTGCGGGTTTTGGTGCGGCTTGAACATCTGGACGTTCAGCTGGAAACTGCTGGATGGGAACAGATGGAACCTGTACACCTTCAGACCAGTCAGCCACTTCAGCCTGAGGGAATTCTGCCACAGGTGCAGTCCATTCTCCTTGGAATTCTTCTTTGGTTGTGGCCTTCTCTGCAGCTGCCTGCTCCTCCTTCTCAATTTCTTCTGGATCACGGTAGAAGTACAGATCGGGCATAACTTCCCAAGGGTGCTCACGAGAGATTGTTCCTCTCATGCGCAGAACCTCACGAGCCAACATCCACCACATTAGACCAACAGAATGAGCACCCTTATTGTTACATGGGATAGCTATATCCACATAGCGCAATGGTGAATCTGTATTACACAAGGCAATGGTAGGAATGTTGACGTATGAAGCCTCAGTAAGGGGTTGGTGATCTGCCCGGGGATCTGTCACCACCAGCAGCCGAGGCTCCCGAAAAGCAGCCTGGATCTGGTTTGGTGAAGGTACCGGGGAGTGAAGCGACCCACCAATAGGTGTGGCACCACTGGCAGAAAGCAATTTCAGTACAGGCTCGCTTGTCCCGTGGTTCCTTGGAAGAAATGAACACACACTTCAGCCAGGAATTTTTCAAATTGCTAACAAATGGGCACCGAGGCAA
Full Trace Sequence: CAGTGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGACCATTCAGTAGTAGTTCCAGTCCATTCTGATGCTTGAGCAGTAGGGGCAGCAGACCAGTCATCAGTGCTTGCAGGCTGAGCACTCCAATCTTCTGCGGGTTTTGGTGCGGCTTGAACATCTGGACGTTCAGCTGGAAACTGCTGGATGGGAACAGATGGAACCTGTACACCTTCAGACCAGTCAGCCACTTCAGCCTGAGGGAATTCTGCCACAGGTGCAGTCCATTCTCCTTGGAATTCTTCTTTGGTTGTGGCCTTCTCTGCAGCTGCCTGCTCCTCCTTCTCAATTTCTTCTGGATCACGGTAGAAGTACAGATCGGGCATAACTTCCCAAGGGTGCTCACGAGAGATTGTTCCTCTCATGCGCAGAACCTCACGAGCCAACATCCACCACATTAGACCAACAGAATGAGCACCCTTATTGTTACATGGGATAGCTATATCCACATAGCGCAATGGTGAATCTGTATTACACAAGGCAATGGTAGGAATGTTGACGTATGAAGCCTCAGTAAGGGGTTGGTGATCTGCCCGGGGATCTGTCACCACCAGCAGCCGAGGCTCCCGAAAAGCAGCCTGGATCTGGTTTGGTGAAGGTACCGGGGAGTGAAGCGACCCACCAATAGGTGTGGCACCACTGGCAGAAAGCAATTTCAGTACAGGCTCGCTTGTCCCGTGGTTCCTTGGAAGAAATGAACACACACTTCAGCCAGGAATTTTTCAAATTGCTAACAAATGGGCACCGAGGCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACCATTCAGTAGTAGTTCCA