ORFeome > rraga ORF1 – XORFeome v1.0

rraga ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rraga
Gene ID: 5756413
Gene Page ID: 5756344
ORF Xenbase ID: 17294763

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124979
Original XGC clone length: 942

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ837372
dbEST ID: 79655074
Trimmed Sequence: ATGCCGAGTTCCGTCATGAAGAAAAAGGTTCTGTTGATGGGAAAGAGTGGGTCTGGAAAGACCAGCATGAGATCCATCATCTTCGCAAACTATATTGCTCGTGATACTCGACGGCTGGGGGCAACAATTGATGTTGAGCACTCTCATGTGCGTTTCTTGGGCAACTTGGTACTGAACCTGTGGGACTGCGGTGGGCAGGACACCTTTATGGAAAACTACTTCACCAGCCAAAGAGATAACATCTTCCGCAACGTGGAGGTCCTCATCTACGTGTTTGACGTGGAGAGCAGAGAGCTGGAGAAGGACATGCATTACTATCAGTCCTGCCTAGAAGCCATCCTGCAGAACTCTCCTGATGCCAAAGTCTTCTGCCTGGTGCACAAGATGGACTTGGTGCAGGAGGACCAGCGGGACCTTATATTTAAAGAGCGGGAGGAGGATCTCAGACGCCTGTCCCGGCCTTTAGACTGTGCCTGCTTTAGGACTTCTATCTGGGATGAGACTCTGTACAAGGCATGGTCCAGTATAGTCTATCAGCTCATTCCCAATGTTCAGCAGCTGGAGTCCAACCTGCGGAATTTCGCTCAGATCATTGAAGCTGATGAGGTGCTGCTGTTTGAGAAGGCTAACGTTTCTGGTCATTTTCCATTACAGTTGTAAAGAACAACGGGACATCCCCAGATTTGAAAAGATCCAACATAAAATTTAACCAATTCCAAGCTAATCTCCAACAAACGGGCCGCCTCCCTCCCAAAATACCGGAGGTTCCAAAATCCGGGATTGGCGTGCCCTTCTTTTACCTTTTTTTCCCCTCCCCACCCC
Full Trace Sequence: CGAGGCCCATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGAGTTCCGTCATGAAGAAAAAGGTTCTGTTGATGGGAAAGAGTGGGTCTGGAAAGACCAGCATGAGATCCATCATCTTCGCAAACTATATTGCTCGTGATACTCGACGGCTGGGGGCAACAATTGATGTTGAGCACTCTCATGTGCGTTTCTTGGGCAACTTGGTACTGAACCTGTGGGACTGCGGTGGGCAGGACACCTTTATGGAAAACTACTTCACCAGCCAAAGAGATAACATCTTCCGCAACGTGGAGGTCCTCATCTACGTGTTTGACGTGGAGAGCAGAGAGCTGGAGAAGGACATGCATTACTATCAGTCCTGCCTAGAAGCCATCCTGCAGAACTCTCCTGATGCCAAAGTCTTCTGCCTGGTGCACAAGATGGACTTGGTGCAGGAGGACCAGCGGGACCTTATATTTAAAGAGCGGGAGGAGGATCTCAGACGCCTGTCCCGGCCTTTAGACTGTGCCTGCTTTAGGACTTCTATCTGGGATGAGACTCTGTACAAGGCATGGTCCAGTATAGTCTATCAGCTCATTCCCAATGTTCAGCAGCTGGAGTCCAACCTGCGGAATTTCGCTCAGATCATTGAAGCTGATGAGGTGCTGCTGTTTGAGAAGGCTAACGTTTCTGGTCATTTTCCATTACAGTTGTAAAGAACAACGGGACATCCCCAGATTTGAAAAGATCCAACATAAAATTTAACCAATTCCAAGCTAATCTCCAACAAACGGGCCGCCTCCCTCCCAAAATACCGGAGGTTCCAAAATCCGGGATTGGCGTGCCCTTCTTTTACCTTTTTTTCCCCTCCCCACCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGAGTTCCGTCATGAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837371
dbEST ID: 79655073
Trimmed Sequence: GCGCATGAGCAGGCTGTGTTTGGGGCCATCCACACGCTCCAGCTTTTCAAAGTGCTTCCTGGCATTGCGGATATTGATTAGAGTTGCAGCAGAGGGGATTGAGGGGTCCGACATCACGACCATCACGTAGGTGTTCGAGGTAAATATGTCAATGAAGGCAGCGAAGTTGGAATTTCGCACCTCCATACTCTGGAAGGAGGCGGCCAGTTTGCTGCAGCTGAGCTTGAACTGCTTAATTATATTGCTGATCTTTTCAAATCTGTGGATGTCCCGTTGTTCTTTACACTGGTAATGGGAAATGACCAGAAACGTAGCCCTCTCAAACAGCAGCACCTCATCAGCCTCAATGATCTGAGCGAAATTCCGCAGGTTGGACTCCAGCTGCTGAACATTGGGAATGAGCTGATAGACTATACTGGACCATGCCTTGTACAGAGTTTCATCCCAGATAGAAGTCCTAAAGCAAGCACAGTCTAAAGGCCGGGACAGGCGTCTGACATCCTCCTCCCGCTCTTTAAATATAAAGTCCCGCGTGGTCGTCCGGCCCCCAAATCCATCTTGTGTACCAGGGCAAAAAACATATACATCGGGAGAGTTCTGCCGGGATGGCTTTTAGGCNGAACTAGTAAGGATGGAGGTCCTGCGTCCACTCTCCTGCGTTCCACTTCAACCCGTAAGAGAAAGAACGCCAACATTGGCGGGACGATGTTATCTCTTTACCCCTTGTGAAAGGGGGGGTTGGGGGGAAGAGTGTTTTTCCTTTCCCT
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGCATGAGCAGGCTGTGTTTGGGGCCATCCACACGCTCCAGCTTTTCAAAGTGCTTCCTGGCATTGCGGATATTGATTAGAGTTGCAGCAGAGGGGATTGAGGGGTCCGACATCACGACCATCACGTAGGTGTTCGAGGTAAATATGTCAATGAAGGCAGCGAAGTTGGAATTTCGCACCTCCATACTCTGGAAGGAGGCGGCCAGTTTGCTGCAGCTGAGCTTGAACTGCTTAATTATATTGCTGATCTTTTCAAATCTGTGGATGTCCCGTTGTTCTTTACACTGGTAATGGGAAATGACCAGAAACGTAGCCCTCTCAAACAGCAGCACCTCATCAGCCTCAATGATCTGAGCGAAATTCCGCAGGTTGGACTCCAGCTGCTGAACATTGGGAATGAGCTGATAGACTATACTGGACCATGCCTTGTACAGAGTTTCATCCCAGATAGAAGTCCTAAAGCAAGCACAGTCTAAAGGCCGGGACAGGCGTCTGACATCCTCCTCCCGCTCTTTAAATATAAAGTCCCGCGTGGTCGTCCGGCCCCCAAATCCATCTTGTGTACCAGGGCAAAAAACATATACATCGGGAGAGTTCTGCCGGGATGGCTTTTAGGCNGAACTAGTAAGGATGGAGGTCCTGCGTCCACTCTCCTGCGTTCCACTTCAACCCGTAAGAGAAAGAACGCCAACATTGGCGGGACGATGTTATCTCTTTACCCCTTGTGAAAGGGGGGGTTGGGGGGAAGAGTGTTTTTCCTTTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGCATGAGCAGGCTGT