ORFeome > rs1 ORF1 – XORFeome v1.0

rs1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rs1
Gene ID: 5848886
Gene Page ID: 5848873
ORF Xenbase ID: 17294853

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123377
Original XGC clone length: 714

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ837754
dbEST ID: 79655456
Trimmed Sequence: ATGGAGCTTCACTGGAACAATGTACTGGTTCTACTTTTTCTGCTTGAAGCTGGAAAATGTGGCAAACCCGAAGATGATACATCAGCCACTTATGTTGATAATGAGACATCCACAAAAGCTCTGATTCCAAATGAATGGCAAAGTAAAAGCAGCAAGTGCGAATGCCAAGGCGGCTATGGATCCTCTCTGATTAACCGAATGATTGCATCTGACTGTATGCCAGAATGTCCATATCATAAACCTGTAGGATTTGAATCAGGGGCTGTGACTTCAGATCAGATCATCTGTTCCAATCAGGAGCAGTACACAGGATGGTATTCATCATGGGCTGCCAACAAGGCAAGACTTAATAGCCAAGGATTTGGTTGTGCATGGCTGTCAAAATTCCAAGATAATGGGCAGTGGCTTCAGATTGATTTTAAGGAAATTAAGGTGATTTCGGGCATAATGACACAGGGAAGGTGTGACGTTGACGAGTGGATCACCAAATACAGTGTTCAGTACAAAATGAATGAAACCTTAAATTGGGTTTACTACAAAGATCAAACAGGAAACAATCGGGTATTTTATGGAAATGCCGACAGATCTTCTACAGTGCAAAATTTCTTGCGTCCTCCAATTGTTGCTCCTTACATCAGGCTCCTTCCCACTGAAAGGGATGTTCGCATTGCTGTTAAAAATGAAACGCTCCAATGCATGAACAAAATTTGCTTTCC
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCTTCACTGGAACAATGTACTGGTTCTACTTTTTCTGCTTGAAGCTGGAAAATGTGGCAAACCCGAAGATGATACATCAGCCACTTATGTTGATAATGAGACATCCACAAAAGCTCTGATTCCAAATGAATGGCAAAGTAAAAGCAGCAAGTGCGAATGCCAAGGCGGCTATGGATCCTCTCTGATTAACCGAATGATTGCATCTGACTGTATGCCAGAATGTCCATATCATAAACCTGTAGGATTTGAATCAGGGGCTGTGACTTCAGATCAGATCATCTGTTCCAATCAGGAGCAGTACACAGGATGGTATTCATCATGGGCTGCCAACAAGGCAAGACTTAATAGCCAAGGATTTGGTTGTGCATGGCTGTCAAAATTCCAAGATAATGGGCAGTGGCTTCAGATTGATTTTAAGGAAATTAAGGTGATTTCGGGCATAATGACACAGGGAAGGTGTGACGTTGACGAGTGGATCACCAAATACAGTGTTCAGTACAAAATGAATGAAACCTTAAATTGGGTTTACTACAAAGATCAAACAGGAAACAATCGGGTATTTTATGGAAATGCCGACAGATCTTCTACAGTGCAAAATTTCTTGCGTCCTCCAATTGTTGCTCCTTACATCAGGCTCCTTCCCACTGAAAGGGATGTTCGCATTGCTGTTAAAAATGAAACGCTCCAATGCATGAACAAAATTTGCTTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCTTCACTGGAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837753
dbEST ID: 79655455
Trimmed Sequence: AGCACATTTGCTCATGCACTCGAGCAGTTCCATTCTCACAGCAATGCGAACATGCCATCCCAGTGGAAGGAGCCTGATGTAACGAGCAACAATTGGAGGACGCAAGAAATTTTGCACTGTAGAAGATCTGTCGGCATTTCCATAAAATACCCGATTGTTTCCTGTTTGATCCTTGTAGTAAACCCAATTTAAGGTTTCATTCATTTTGTACTGAACACTGTATTTGGTGATCCACTCGTCAACGTCACACCTTCCCTGTGTCATTATGCCCGAAATCACCTTAATTTCCTTAAAATCAATCTGAAGCCACTGCCCATTATCTTGGAATTTTGACAGCCATGCACAACCAAATCCTTGGCTATTAAGTCTTGCCTTGTTGGCAGCCCATGATGAATACCATCCTGTGTACTGCTCCTGATTGGAACAGATGATCTGATCTGAAGTCACAGCCCCTGATTCAAATCCTACAGGTTTATGATATGGACATTCTGGCATACAGTCAGATGCAATCATTCGGTTAATCAGAGAGGATCCATAGCCGCCTTGGCATTCGCACTTGCTGCTTTTACTTTGCCATTCATTTGGAATCAGAGCTTTTGTGGATGTCTCATTATCAACATAAGTGGCTGATGTATCATCTTCGGGTTTGCCACAGTTTCCAGCTTCAAGCAAAAAAAATAGAACCAGTACATTGTTCCAGTGAAGCTCCATGG
Full Trace Sequence: CGGCCAGGGCAACAGCTTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCACATTTGCTCATGCACTCGAGCAGTTCCATTCTCACAGCAATGCGAACATGCCATCCCAGTGGAAGGAGCCTGATGTAACGAGCAACAATTGGAGGACGCAAGAAATTTTGCACTGTAGAAGATCTGTCGGCATTTCCATAAAATACCCGATTGTTTCCTGTTTGATCCTTGTAGTAAACCCAATTTAAGGTTTCATTCATTTTGTACTGAACACTGTATTTGGTGATCCACTCGTCAACGTCACACCTTCCCTGTGTCATTATGCCCGAAATCACCTTAATTTCCTTAAAATCAATCTGAAGCCACTGCCCATTATCTTGGAATTTTGACAGCCATGCACAACCAAATCCTTGGCTATTAAGTCTTGCCTTGTTGGCAGCCCATGATGAATACCATCCTGTGTACTGCTCCTGATTGGAACAGATGATCTGATCTGAAGTCACAGCCCCTGATTCAAATCCTACAGGTTTATGATATGGACATTCTGGCATACAGTCAGATGCAATCATTCGGTTAATCAGAGAGGATCCATAGCCGCCTTGGCATTCGCACTTGCTGCTTTTACTTTGCCATTCATTTGGAATCAGAGCTTTTGTGGATGTCTCATTATCAACATAAGTGGCTGATGTATCATCTTCGGGTTTGCCACAGTTTCCAGCTTCAAGCAAAAAAAATAGAACCAGTACATTGTTCCAGTGAAGCTCCATGGTGCCAAGCTTTTTGTACAAAGTTGGCATTGGAAAAAGCATTGCTCCACAGTTTGTTGCAACGAAGAGGTCAGTGTGGGTTCGAATTAAGATCAAAAAAAAAAGAAATAAAGAAAGAATGAGCGGCCGTTAAAACGGCCAAGAACATGGAATACAAAGACCTCCCGCGGGACCAAGGTGGTGGGGGTTATAAGCTTGGGGGAAAGAAAGGGGACCGCGCCAAGGGAGAGAAGCGCCGGGGGGGGGGTAAAGAGAAATGAAAGAAAGGGGAAGGCGCGCCGAAAGGAGGAAAAGAATGAGGAGGAGGACGGGGGGGAAAGGGGGAGGGGGGATTAATTTAGTAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGAGAAAAACAACGCAAGCAGCCCGACGCAGACGAGCNCGAGGGGGCGAGAAGAGGAGGGGGGGAGGAAGGGAGAAGGAAAAAGAAAGAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCACATTTGCTCATGCAC