ORFeome > rsl24d1 ORF1 – XORFeome v1.0

rsl24d1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rsl24d1
Gene ID: 979830
Gene Page ID: 979825
ORF Xenbase ID: 17294865

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042273
Original XGC clone length: 492

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ824366
dbEST ID: 79642068
Trimmed Sequence: ATGCGAGTGGAAAAGTGTTACTTCTGCTCCGCGCCCATTTACCCAGGGCACGGGATGATGTTCGTGAGGAACGACAGTAAGGTTTTTAGGTTCTGCAGGTCAAAATGCCACAAGAATTTCAAGAAGAAGCGCAACCCTAGAAAGATCAGGTGGACCAAAGCATTCAGAAAATCGGCTGGTAAAGAGTTGACCGTGGATAATTCATTTGAATTTGAAAAAAGAAGAAATGAACCTGTCAAATATCAGAGAGAATTGTGGAGCAAGTCAGTTGAGGCAATGAAGAGAGTTGAAGAAATCAAGCAGAAGAGACAGGCTCGGTTTATCATGAATAGACTGAAAAAGGGCAAAGAGTTGCAAAAAGCACAGGATATCAAAGAAGTCAAACAGAACATTCATCTTATTCGGGCTCCTCATGCTGGAAAGGCAAAACAGCTGGAAGACAAAATGGTTCAGAAATTACAAGAGGATGTGGACATGGAAGATCCTTCCTT
Full Trace Sequence: AAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGAGTGGAAAAGTGTTACTTCTGCTCCGCGCCCATTTACCCAGGGCACGGGATGATGTTCGTGAGGAACGACAGTAAGGTTTTTAGGTTCTGCAGGTCAAAATGCCACAAGAATTTCAAGAAGAAGCGCAACCCTAGAAAGATCAGGTGGACCAAAGCATTCAGAAAATCGGCTGGTAAAGAGTTGACCGTGGATAATTCATTTGAATTTGAAAAAAGAAGAAATGAACCTGTCAAATATCAGAGAGAATTGTGGAGCAAGTCAGTTGAGGCAATGAAGAGAGTTGAAGAAATCAAGCAGAAGAGACAGGCTCGGTTTATCATGAATAGACTGAAAAAGGGCAAAGAGTTGCAAAAAGCACAGGATATCAAAGAAGTCAAACAGAACATTCATCTTATTCGGGCTCCTCATGCTGGAAAGGCAAAACAGCTGGAAGACAAAATGGTTCAGAAATTACAAGAGGATGTGGACATGGAAGATCCTTCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTAATGGTCATAGCTGTTTCCTGGCACTCTGGCCGGAGATCCAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAATNNNNANTTTTTTTTTTCCCCCTCCCCTNNCCCTTTCCTTTTTCCCNCTCCTTTTCCCCTTTCCCCCCCCCCCNTCTTTTTATATAAAAAAAAAATCCTTTAAAAACACAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGAGTGGAAAAGTGTTAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829725
dbEST ID: 79647427
Trimmed Sequence: GGAAGGATCTTCCATGTCCACATCCTCTTGTAATTTCTGAACCATTTTGTCTTCCAGCTGTTTTGCCTTTCCAGCATGAGGAGCCCGAATAAGATGAATGTTCTGTTTGACTTCTTTGATATCCTGTGCTTTTTGCAACTCTTTGCCCTTTTTCAGTCTATTCATGATAAACCGAGCCTGTCTCTTCTGCTTGATTTCTTCAACTCTCTTCATTGCCTCAACTGACTTGCTCCACAATTCTCTCTGATATTTGACAGGTTCATTTCTTCTTTTTTCAAATTCAAATGAATTATCCACGGTCAACTCTTTACCAGCCGATTTTCTGAATGCTTTGGTCCACCTGATCTTTCTAGGGTTGCGCTTCTTCTTGAAATTCTTGTGGCATTTTGACCTGCAGAACCTAAAAACCTTACTGTCGTTCCTCACGAACATCATCCCGTGCCCTGGGTAAATGGGCGCGGAGCAGAAGTAACACTTTTCCACTCGCATGG
Full Trace Sequence: GGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAAGGATCTTCCATGTCCACATCCTCTTGTAATTTCTGAACCATTTTGTCTTCCAGCTGTTTTGCCTTTCCAGCATGAGGAGCCCGAATAAGATGAATGTTCTGTTTGACTTCTTTGATATCCTGTGCTTTTTGCAACTCTTTGCCCTTTTTCAGTCTATTCATGATAAACCGAGCCTGTCTCTTCTGCTTGATTTCTTCAACTCTCTTCATTGCCTCAACTGACTTGCTCCACAATTCTCTCTGATATTTGACAGGTTCATTTCTTCTTTTTTCAAATTCAAATGAATTATCCACGGTCAACTCTTTACCAGCCGATTTTCTGAATGCTTTGGTCCACCTGATCTTTCTAGGGTTGCGCTTCTTCTTGAAATTCTTGTGGCATTTTGACCTGCAGAACCTAAAAACCTTACTGTCGTTCCTCACGAACATCATCCCGTGCCCTGGGTAAATGGGCGCGGAGCAGAAGTAACACTTTTCCACTCGCATGGTGCCCACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAATTCATTATTATGAAACCGAGACTAAAGACTGGCCGTCGTTTAACCCCCNNNGNTAGCCGGGGGAANNNTGNNAAACNNTTTTTNGCAAGGAAACCTACTGAACACCTGTATTCTCGCATATGGGAAGTGGATTCCCGGGTACAAATTTCCCGGCCAGTTTGCAAACCGATAAACTACTCCCAAAAAATTTGAAGCGGTGCTCACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAAGGATCTTCCATGTC