ORFeome > rtcb ORF1 – XORFeome v1.0

rtcb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rtcb
Gene ID: 974756
Gene Page ID: 974750
ORF Xenbase ID: 17294925

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123248
Original XGC clone length: 1518

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ838243
dbEST ID: 79655945
Trimmed Sequence: ATGAGCCGCAGTTACAATGACGAGTTACAGTATCTGGACAAGATCCATAACAACTGCTGGCGGATCCGCAAGGGTTTCGTGCCCAACATGCAGGTGGAAGGGGTCTTCTATGTGAATGATCCTCTGGAGAAGCTGATGTTTGAGGAGCTGAGGAACGCGAGCCGCGGTGGAGCCGCTGGAGGGTTCCTTCCTGCCATGAAGCAGATCGGCAACGTCGCAGCTTTACCTGGGATTGTTCACAGATCCATTGGGCTACCAGATGTCCACTCCGGCTATGGATTTGCCATTGGAAACATGGCGGCATTTGATATGGAAAACCCTGATGCCGTTGTCTCCCCAGGTGGTGTTGGTTTTGACATCAACTGTGGGGTCCGATTGCTTCGTACAAACCTGGATGAGAGTGACGTGCAGCCAGTGAAGGAGCAGCTTGCCCAGTCCATGTTCGACCATATCCCTGTAGGGGTCGGATCCAAAGGGGTCATCCCTATGGGAGCCAAGGACCTTGAGGAAGCCCTTGAGATGGGGGTGGACTGGTCGCTGCGACAAGGCTACGCCTTGGCCGAGGACAAAGAACACTGCGAGGAATATAGCCGAATGCTTCAAGTCGACCCCACCCAGGTCTCCTCTAAAGCCAAAAAAACAAAACCGGCCCCCGCCGGGGGACCCTCCGGTGCCCGAAGCCAGTTACACACCAAAATCCAAGTTGGTTTAATAAAGTTTTAGGAACAAATTACCCCCCCAAAAAAAATGGGGCCAACAAACCAAAAAGGTGGGCAGAGGTGTTTTGGTGGGTGAAGTCC
Full Trace Sequence: GCGGGCTCCAAATAATGGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCGCAGTTACAATGACGAGTTACAGTATCTGGACAAGATCCATAACAACTGCTGGCGGATCCGCAAGGGTTTCGTGCCCAACATGCAGGTGGAAGGGGTCTTCTATGTGAATGATCCTCTGGAGAAGCTGATGTTTGAGGAGCTGAGGAACGCGAGCCGCGGTGGAGCCGCTGGAGGGTTCCTTCCTGCCATGAAGCAGATCGGCAACGTCGCAGCTTTACCTGGGATTGTTCACAGATCCATTGGGCTACCAGATGTCCACTCCGGCTATGGATTTGCCATTGGAAACATGGCGGCATTTGATATGGAAAACCCTGATGCCGTTGTCTCCCCAGGTGGTGTTGGTTTTGACATCAACTGTGGGGTCCGATTGCTTCGTACAAACCTGGATGAGAGTGACGTGCAGCCAGTGAAGGAGCAGCTTGCCCAGTCCATGTTCGACCATATCCCTGTAGGGGTCGGATCCAAAGGGGTCATCCCTATGGGAGCCAAGGACCTTGAGGAAGCCCTTGAGATGGGGGTGGACTGGTCGCTGCGACAAGGCTACGCCTTGGCCGAGGACAAAGAACACTGCGAGGAATATAGCCGAATGCTTCAAGTCGACCCCACCCAGGTCTCCTCTAAAGCCAAAAAAACAAAACCGGCCCCCGCCGGGGGACCCTCCGGTGCCCGAAGCCAGTTACACACCAAAATCCAAGTTGGTTTAATAAAGTTTTAGGAACAAATTACCCCCCCAAAAAAAATGGGGCCAACAAACCAAAAAGGTGGGCAGAGGTGTTTTGGTGGGTGAAGTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCGCAGTTACAATGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838242
dbEST ID: 79655944
Trimmed Sequence: ACCTTTGATGACCGCAATGGGGCGCAGCTTGATGGCTTTCTTGCTGATGCCGGCATCGTGACAGGTATTCACTACATCTGTGACGTTCTTGTACGATTCAGGAGCCTCTTCCATGACCAGTTTTGGGGAAGCCACGCGGATGGCGATGCCCAGGTCAGCCAGTTTGTCCAGCACATCTTGGAAATCAAGGTTTCTTCTTGATTTGGCTCTGGAGAGGGCGCGACCAGCACCATGGCAGGTAGTGCCAAACGTCTCAGTCATGCCCTGGTCAGTTCCAGTGAGGACATAGCTGCAGGTTCCCATGGTCCCACCGATCAATACCGGCTGCCCAGTCAACTGATAATCCACAGGAATGAGCGGGTGATGGGGAGGGAAGGCTCGGGTGGCCCCCTTTCTGTGCACCAGCAGAGTCATCTCCTTCCCCTCCACCACATGTTGCTCCACCTTGGCGATGTTGTGGGACACGTCGTAGATCACGTGCATGTCCAGGTCGTCGGGAGGCGTGTTGAATACTTTGGAGAAGGCCTGTCTGGTGAGGAAGGTCATGGAGGAGCGGTTGACCCAAGCCTAATTGCCCGCGGCAGCCATGCCCTTTGAAGTAATCCCGCCCCCTCGTCCAAAGAAATGGCGGGCGCCTGCCAACTGTCCAATCATTTCACCGTTGATCTTGTCCCTCCTCCATCCGCTTTTCTCC
Full Trace Sequence: CGGAAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCTTTGATGACCGCAATGGGGCGCAGCTTGATGGCTTTCTTGCTGATGCCGGCATCGTGACAGGTATTCACTACATCTGTGACGTTCTTGTACGATTCAGGAGCCTCTTCCATGACCAGTTTTGGGGAAGCCACGCGGATGGCGATGCCCAGGTCAGCCAGTTTGTCCAGCACATCTTGGAAATCAAGGTTTCTTCTTGATTTGGCTCTGGAGAGGGCGCGACCAGCACCATGGCAGGTAGTGCCAAACGTCTCAGTCATGCCCTGGTCAGTTCCAGTGAGGACATAGCTGCAGGTTCCCATGGTCCCACCGATCAATACCGGCTGCCCAGTCAACTGATAATCCACAGGAATGAGCGGGTGATGGGGAGGGAAGGCTCGGGTGGCCCCCTTTCTGTGCACCAGCAGAGTCATCTCCTTCCCCTCCACCACATGTTGCTCCACCTTGGCGATGTTGTGGGACACGTCGTAGATCACGTGCATGTCCAGGTCGTCGGGAGGCGTGTTGAATACTTTGGAGAAGGCCTGTCTGGTGAGGAAGGTCATGGAGGAGCGGTTGACCCAAGCCTAATTGCCCGCGGCAGCCATGCCCTTTGAAGTAATCCCGCCCCCTCGTCCAAAGAAATGGCGGGCGCCTGCCAACTGTCCAATCATTTCACCGTTGATCTTGTCCCTCCTCCATCCGCTTTTCTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCTTTGATGACCGCAATG