ORFeome > rtfdc1 ORF1 – XORFeome v1.0

rtfdc1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rtfdc1
Gene ID: 6255767
Gene Page ID: 5854990
ORF Xenbase ID: 17294931

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054212
Original XGC clone length: 915

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ839351
dbEST ID: 79657053
Trimmed Sequence: ATGGGTTGCGACGGGGGAACGATTCCAAAGCGGCACGAGCTTGTAAAGGGGCCCAAGAAGGTGGAAAAGGTTGATAAAAACGCAGAGTTGGTGGCCCGCTGGTTCTACTGCACATTAAGTCAGGAGAGACTCACCAAGCCAATTGTGGCCTGTGAACTGGGCAGGCTTTACAACAAGGATGCAGTGATTGAGTTCTTACTGGACAAGTCACCTGACAAACCCCACGCCGACTCAGCTGCACATATTAAGGGCATCAAGAGTATCATCGAACTGAACCTGAGTGATAATCCCGCATGGACAGGGCGAAAAGGGAACACAAAAGGCGATACATACGATGATCAGTGTGCTCAGTTTATCTGCCCAGTGGTGGGCCTGGAAATGAATGGCAAACACAGGTTTTGTGTACTGCGGAAATGTGGCTGCGTGTTCTCTGAGCGGGCGCTGAAAGAAATCAAAACAGATGTCTGCCACAAGTGCGGAGCCAGCTTTCAGGAAACTGATCTGATTTTGTTAAACGGCGACAAGGAAGAAGTGGAGGAACTGAGGAAAAAAATGGAAGAACGAAGACTGAAGGCTAAATCTGAAAAGAAAGGAAAAAAAACCAAAGCAGTTGAGTCTGTTTCAAGGTCTGATCAAGGAAAAGAATCTCCCGGATCATCGCAGAAGGGGAAAAAAAAATACAAACATTCCCCAAAGACAGAACCCTTTTTGTTTTCCATTGCCAAAACCCAGAATTCCACATTCATCCCTCGTCTTAAGGCACCCCCCCAAATCCTTTCAACTTTCCTTCCTCGCACAAAAAGGGCCCTGTCGTTCAAAGCCAGCCGG
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTTGCGACGGGGGAACGATTCCAAAGCGGCACGAGCTTGTAAAGGGGCCCAAGAAGGTGGAAAAGGTTGATAAAAACGCAGAGTTGGTGGCCCGCTGGTTCTACTGCACATTAAGTCAGGAGAGACTCACCAAGCCAATTGTGGCCTGTGAACTGGGCAGGCTTTACAACAAGGATGCAGTGATTGAGTTCTTACTGGACAAGTCACCTGACAAACCCCACGCCGACTCAGCTGCACATATTAAGGGCATCAAGAGTATCATCGAACTGAACCTGAGTGATAATCCCGCATGGACAGGGCGAAAAGGGAACACAAAAGGCGATACATACGATGATCAGTGTGCTCAGTTTATCTGCCCAGTGGTGGGCCTGGAAATGAATGGCAAACACAGGTTTTGTGTACTGCGGAAATGTGGCTGCGTGTTCTCTGAGCGGGCGCTGAAAGAAATCAAAACAGATGTCTGCCACAAGTGCGGAGCCAGCTTTCAGGAAACTGATCTGATTTTGTTAAACGGCGACAAGGAAGAAGTGGAGGAACTGAGGAAAAAAATGGAAGAACGAAGACTGAAGGCTAAATCTGAAAAGAAAGGAAAAAAAACCAAAGCAGTTGAGTCTGTTTCAAGGTCTGATCAAGGAAAAGAATCTCCCGGATCATCGCAGAAGGGGAAAAAAAAATACAAACATTCCCCAAAGACAGAACCCTTTTTGTTTTCCATTGCCAAAACCCAGAATTCCACATTCATCCCTCGTCTTAAGGCACCCCCCCAAATCCTTTCAACTTTCCTTCCTCGCACAAAAAGGGCCCTGTCGTTCAAAGCCAGCCGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTTGCGACGGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839350
dbEST ID: 79657052
Trimmed Sequence: GAAGTAGTAAGCAGTGTGGGTGATCCAGTTGGACGACTGGTCCTTTGAGCGTTTAGCGGAGCTGTGGGATGTGAAGATGGATTTATAGGCCTCAGACTTCCTCTCGCTGCTTGACGCAGGCCTTTTGCTGCAGAAGGATGTAGAAGATTTGGTGGCTGCATCAGACGAGGATGAGTGTGAATCTTGTGTTTTGGCACTGGAAACAAAATGGATCTTGTCTCTGGGAATGTTTGTATCTTCTTTCTCCTTCTGCGATGATCCTGGAGATTCTTCTCCTTGATCAGACCTTGAAACAGACTCAACTGCTTTGGTTTTTTTTCCTTTCTTTTCAGATTTAGCCTTCAGTCTTCGTTCTTCCATTTTTTTCCTCAGTTCCTCCACTTCTTCCTTGTCGCCGTTTAACAAAATCAGATCAGTTTCCTGAAAGCTGGCTCCGCACTTGTGGCAGACATCTGTTTTGATTTCTTTCAGCGCCCGCTCAGAGAACACGCAGCCACATTTCCGCAGTACACAAAACCTGTGTTTGCCATTCATTTCCAGGCCCACCACTGGGCAGATAAACTGAGCACACTGATCATCGTATGTATCGCCTTTTGTGTTCCCTTTTCGCCCTGTCCATGCGGGGATATCACTCAGGTTCAGTTTCAATGATACTCTTGATGCCCTTAATATGTGCAGCTGAATCCGGCGTGGGGGTTTTGTCAGGGGGACTTTGTCCAGTAAGAAACTCAAATCCACTGCCTTCCCTTGGTGGTAAAAGCCGTGCCCCA
Full Trace Sequence: CGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGTAGTAAGCAGTGTGGGTGATCCAGTTGGACGACTGGTCCTTTGAGCGTTTAGCGGAGCTGTGGGATGTGAAGATGGATTTATAGGCCTCAGACTTCCTCTCGCTGCTTGACGCAGGCCTTTTGCTGCAGAAGGATGTAGAAGATTTGGTGGCTGCATCAGACGAGGATGAGTGTGAATCTTGTGTTTTGGCACTGGAAACAAAATGGATCTTGTCTCTGGGAATGTTTGTATCTTCTTTCTCCTTCTGCGATGATCCTGGAGATTCTTCTCCTTGATCAGACCTTGAAACAGACTCAACTGCTTTGGTTTTTTTTCCTTTCTTTTCAGATTTAGCCTTCAGTCTTCGTTCTTCCATTTTTTTCCTCAGTTCCTCCACTTCTTCCTTGTCGCCGTTTAACAAAATCAGATCAGTTTCCTGAAAGCTGGCTCCGCACTTGTGGCAGACATCTGTTTTGATTTCTTTCAGCGCCCGCTCAGAGAACACGCAGCCACATTTCCGCAGTACACAAAACCTGTGTTTGCCATTCATTTCCAGGCCCACCACTGGGCAGATAAACTGAGCACACTGATCATCGTATGTATCGCCTTTTGTGTTCCCTTTTCGCCCTGTCCATGCGGGGATATCACTCAGGTTCAGTTTCAATGATACTCTTGATGCCCTTAATATGTGCAGCTGAATCCGGCGTGGGGGTTTTGTCAGGGGGACTTTGTCCAGTAAGAAACTCAAATCCACTGCCTTCCCTTGGTGGTAAAAGCCGTGCCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGTAGTAAGCAGTGTGGGT