ORFeome > ruvbl2 ORF1 – XORFeome v1.0

ruvbl2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ruvbl2
Gene ID: 483348
Gene Page ID: 483343
ORF Xenbase ID: 17294979

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123265
Original XGC clone length: 1389

Human orthology & disease relationships

NCBI Entrez ID: 10856
Ensembl gene IDs: ENSG00000183207
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,103050,124900,125800,146300,161800,180105,182290,214150,222900,241500,241510,266200,268000,300291,300301,300584,301000,308300,313400,313900,600652,601675,603278,603622,605249,607841,608688,608751,610015

Library Location

Plate ID: GDExl11092
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ838771
dbEST ID: 79656473
Trimmed Sequence: ATGGCAACCATGGCGGCAACCAAGGTGCCAGAGGTGCGAGACGTCACCCGAATTGAGAGGATCGGTGCACACTCTCACATCAGAGGGCTTGGCCTTGACGATGCATTGGAACCCCGCCAGGTATCGCACGGCATGGTGGGACAACTGTGTGACCCTGATGGACATGGAGTCTTTTTGTTGGGAGCTCTTGGGTTTGGAGTGTTANGAGATCCGGTGTTTTGTGGGAGACGGGAAGAGTTTGGAGATGAGTTTAAGCGGTGAGTGGGCTATGACTATATGGACATTACTGTGATAGGAAGGCCACAGGTGCAAATGAAGAGTTTTTTGTGTGGATGAGACTCTTTATGTTGGGAGGNAGGTGTGATAATGTTTCTATGTGTTGCAATTAATAATGCTAATCTGACGGGAATCGGTGGGATGTGGAATATTGAAATTGGATAATCCGTATATAGTGCTACTTAAGATAGTGAGGAGAGTCTTATACGGACTTTAGAGGGAATATATAAGTTCTGGAATATACAGGGTGTGACTTTTACGAAAAAATGTGTCCCCGGTAGATAATACAGTCCACTGATGATATCCTCATAGCAATTAAGGTAGTTGTTGTGCTCTATTGTAGAGTGTTTTTTGGTGTGAGGGAATAGAAAAAGTGGACTCTCGTGGATATTGGTGAGCATCATTGCGAGAATTAGAATATTTAATGATCTAGTTAACTAGATTCTCCCGAGGTGAGATAAGCATTTATTTATTGCTATAAAAGGGATTGTTTCTGTGAGGGGGAGTAATATTGGTTGTATA
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACCATGGCGGCAACCAAGGTGCCAGAGGTGCGAGACGTCACCCGAATTGAGAGGATCGGTGCACACTCTCACATCAGAGGGCTTGGCCTTGACGATGCATTGGAACCCCGCCAGGTATCGCACGGCATGGTGGGACAACTGTGTGACCCTGATGGACATGGAGTCTTTTTGTTGGGAGCTCTTGGGTTTGGAGTGTTANGAGATCCGGTGTTTTGTGGGAGACGGGAAGAGTTTGGAGATGAGTTTAAGCGGTGAGTGGGCTATGACTATATGGACATTACTGTGATAGGAAGGCCACAGGTGCAAATGAAGAGTTTTTTGTGTGGATGAGACTCTTTATGTTGGGAGGNAGGTGTGATAATGTTTCTATGTGTTGCAATTAATAATGCTAATCTGACGGGAATCGGTGGGATGTGGAATATTGAAATTGGATAATCCGTATATAGTGCTACTTAAGATAGTGAGGAGAGTCTTATACGGACTTTAGAGGGAATATATAAGTTCTGGAATATACAGGGTGTGACTTTTACGAAAAAATGTGTCCCCGGTAGATAATACAGTCCACTGATGATATCCTCATAGCAATTAAGGTAGTTGTTGTGCTCTATTGTAGAGTGTTTTTTGGTGTGAGGGAATAGAAAAAGTGGACTCTCGTGGATATTGGTGAGCATCATTGCGAGAATTAGAATATTTAATGATCTAGTTAACTAGATTCTCCCGAGGTGAGATAAGCATTTATTTATTGCTATAAAAGGGATTGTTTCTGTGAGGGGGAGTAATATTGGTTGTATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACCATGGCGGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838770
dbEST ID: 79656472
Trimmed Sequence: GGATGTCTCCATGGTGTCCGTTTTCATTTCATTAAACATAAAGGCATCCTGGTATTCCTTCATGTACTGTGTTGACCGTGACTCATCAAGAAAGAGCGAGTATACCCGTTTGATATCATCCACTTGCACCTCGGTTCCCTTCCTCTTCCTACAGACCAAGCTAGCTGCTGTGATAAGCTGCATGGAATATCGGAGAGAAGTCTCTAGGCCGATCCTTGTCAGAACAGTGTAAGCATCTTCACTCATATCCACGTCTTCCTCCTCGCACCTGATCTTTAGGATCTGTTTGGTCTCTTTTTCATTGTATGGCGAGGTGGAGATAATGAGTAACCGATCCAATAAATCAATAGGAATTCCATGGGGACTCTGGTAGTTCGTGCCACGAATTCTGGTTATTCCTCTGTTTGTGGCCATTATGAGAACAGGGGCCATGTCACTTTCCAAAGCTCTATTCAGAAAGGAGAAGCATTCAATATCCAGCATGTGAACCTCATCTATGAATAACACACCAAGAATAGTTTCAGCCTTCCCCTCTTCTCTCCATTCTGCAACTTTCACAATGATATGTTCTCGCACCTCTGATTTAATTTCCCCTGTATCTCGTGAAAAGAGAACAAGAAAACCTTGCCTCCGACTGGTTTACACATCAATTTTCATCAATTACACCGTAAGAAACAACTTCCTTTCCCTTCTAAAACTCCCCCTCCAGGCCACCTGAAAAAGGTGAATCCTAAAACCCCAAGGCCCACCCAAAACCCCGGGGG
Full Trace Sequence: GGAACGANGCTATGGACCATGTAATACGACTCACTATANGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGATGTCTCCATGGTGTCCGTTTTCATTTCATTAAACATAAAGGCATCCTGGTATTCCTTCATGTACTGTGTTGACCGTGACTCATCAAGAAAGAGCGAGTATACCCGTTTGATATCATCCACTTGCACCTCGGTTCCCTTCCTCTTCCTACAGACCAAGCTAGCTGCTGTGATAAGCTGCATGGAATATCGGAGAGAAGTCTCTAGGCCGATCCTTGTCAGAACAGTGTAAGCATCTTCACTCATATCCACGTCTTCCTCCTCGCACCTGATCTTTAGGATCTGTTTGGTCTCTTTTTCATTGTATGGCGAGGTGGAGATAATGAGTAACCGATCCAATAAATCAATAGGAATTCCATGGGGACTCTGGTAGTTCGTGCCACGAATTCTGGTTATTCCTCTGTTTGTGGCCATTATGAGAACAGGGGCCATGTCACTTTCCAAAGCTCTATTCAGAAAGGAGAAGCATTCAATATCCAGCATGTGAACCTCATCTATGAATAACACACCAAGAATAGTTTCAGCCTTCCCCTCTTCTCTCCATTCTGCAACTTTCACAATGATATGTTCTCGCACCTCTGATTTAATTTCCCCTGTATCTCGTGAAAAGAGAACAAGAAAACCTTGCCTCCGACTGGTTTACACATCAATTTTCATCAATTACACCGTAAGAAACAACTTCCTTTCCCTTCTAAAACTCCCCCTCCAGGCCACCTGAAAAAGGTGAATCCTAAAACCCCAAGGCCCACCCAAAACCCCGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATGTCTCCATGGTGTCCGT