ORFeome > ruvbl2-prov ORF1 – XORFeome v1.0

ruvbl2-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256593
Gene Page ID:
ORF Xenbase ID: 17294985

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047966
Original XGC clone length: 1389

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ823891
dbEST ID: 79641593
Trimmed Sequence: ATGGCAACCATGGCGGCAACCAAGGTGCCAGAGGTGCGAGATGTCACTCGAATTGAAAGGATCGGTGCACATTCTCACATCAGAGGGCTGGGCCTTGACGATGCGTTGGAACCCCGTCAGGTATCGCAGGGCATGGTGGGACAGCTGGCATCCAGGAGGGCAGCAGGAGTTATTCTGGAAATGATCAAAGAAGGGAAGATTGCTGGGAGAGCAGTGCTCATTGCTGGGCAACCAGGCACAGGAAAAACCGCCATTGCTATGGGTATGGCTCAGGCTTTGGGCTCTGACACCCCTTTTACAGCCATTGCTGGTAGTGAAATCTTTTCACTGGAAATGAGCAAAACCGAGGCTCTGACGCAAGCTTTCCGGAGGTCCATTGGTGTGAGGATTAAGGAAGAAACAGAAATCATTGAAGGGGAAGTTGTTGAAGTTCAGATTGATAGACCTGCCACTGGAACAGGTGCAAAAGTTGGAAAGCTGACTCTGAAGACAACAGAGATGGAGACCATTTATGATCTTGGAACAAAGATGATTGAGTCTTTGACAAAGGAAAAAGTACAGGCAGGGGATGTAATTACTATTGATAAAGCCACAGGCAAAATAACAAGNCTGGGTCGTGCCTTCACAAGGGCCCGTGATTATGATGCCATGGGATCTCAGACTAAATTCGTTCGNTGCCCCGACGGGGAGCTCCAGAGGCGCAAGGAGTAATAAAATCCGGTGTCGCTGCATGGAAATGACCTGGATAACAGTCGGAAACCAGGGATTCCTGGCCCCCTTTTGGGGCCACCAGGGAAAATTTAAAATTAAAAGGTCCAGACCAAATCATCCTTAATTTCCTAAAAAGAA
Full Trace Sequence: TAATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACCATGGCGGCAACCAAGGTGCCAGAGGTGCGAGATGTCACTCGAATTGAAAGGATCGGTGCACATTCTCACATCAGAGGGCTGGGCCTTGACGATGCGTTGGAACCCCGTCAGGTATCGCAGGGCATGGTGGGACAGCTGGCATCCAGGAGGGCAGCAGGAGTTATTCTGGAAATGATCAAAGAAGGGAAGATTGCTGGGAGAGCAGTGCTCATTGCTGGGCAACCAGGCACAGGAAAAACCGCCATTGCTATGGGTATGGCTCAGGCTTTGGGCTCTGACACCCCTTTTACAGCCATTGCTGGTAGTGAAATCTTTTCACTGGAAATGAGCAAAACCGAGGCTCTGACGCAAGCTTTCCGGAGGTCCATTGGTGTGAGGATTAAGGAAGAAACAGAAATCATTGAAGGGGAAGTTGTTGAAGTTCAGATTGATAGACCTGCCACTGGAACAGGTGCAAAAGTTGGAAAGCTGACTCTGAAGACAACAGAGATGGAGACCATTTATGATCTTGGAACAAAGATGATTGAGTCTTTGACAAAGGAAAAAGTACAGGCAGGGGATGTAATTACTATTGATAAAGCCACAGGCAAAATAACAAGNCTGGGTCGTGCCTTCACAAGGGCCCGTGATTATGATGCCATGGGATCTCAGACTAAATTCGTTCGNTGCCCCGACGGGGAGCTCCAGAGGCGCAAGGAGTAATAAAATCCGGTGTCGCTGCATGGAAATGACCTGGATAACAGTCGGAAACCAGGGATTCCTGGCCCCCTTTTGGGGCCACCAGGGAAAATTTAAAATTAAAAGGTCCAGACCAAATCATCCTTAATTTCCTAAAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACCATGGCGGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829200
dbEST ID: 79646902
Trimmed Sequence: GGATGTGTCCATGGTGTCCGTTTTCATTTCATTAAACATAAAGGCATCCTGGTACTCCTTCATGTACTGTGTTGACCGAGACTCATCAAGAAAGAGAGAGTACACTCGTTTGATATCATCCACTTGCACTTCGGTTCCCTTCCTCTTCCTGCAGACCAAGCTAGCAGCTGTGATAAGCTGCATGGAATATCTGAGAGATGTCTCTAGGCCGATCCTTGTCAGAACAGTGCAAGCATCTTCACTCATATCGACATCTTCCTCCTCACACCTGATTTTTAAGATCTGTTTGGTCTCTTTTTCATTGTATGGTGATGTGGAGATAATGAGTAGCCGATCCAGTAAATCAATAGGGATTCCATGGGGGGACTGGTAGTTCGTGCCACGAATTCTGGTTATTCCTCTGTTTGTGGCCATTATGAGAACAGGGGCCATGTCACTTTCCAAAGCTCGATTCAAGAAGGAGAAGCATTCTATATCCAGCATGTGCACCTCATCTATGAATAGCACACCAGGAATAATCTCAGCCTTCCCTTCCTCTCTCCATTCTGCAACTTTCGCATTGATCTGTTCTCGCACCTCTGATTTAATCTCTCCTGTGTCGCCTGAAAAGAGAGCAAGGGATTCTTTGCGTCCGACTGTTTATCACGTCAATTTCCTGCAGCGACCCCGTATGTACTACCTTCTTGGCCCTTCCTGGAGCTCCCCCGTCGGGGGCAACGAAAACGAAATTTAATCCTGAAAAATTCCCATG
Full Trace Sequence: GGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGATGTGTCCATGGTGTCCGTTTTCATTTCATTAAACATAAAGGCATCCTGGTACTCCTTCATGTACTGTGTTGACCGAGACTCATCAAGAAAGAGAGAGTACACTCGTTTGATATCATCCACTTGCACTTCGGTTCCCTTCCTCTTCCTGCAGACCAAGCTAGCAGCTGTGATAAGCTGCATGGAATATCTGAGAGATGTCTCTAGGCCGATCCTTGTCAGAACAGTGCAAGCATCTTCACTCATATCGACATCTTCCTCCTCACACCTGATTTTTAAGATCTGTTTGGTCTCTTTTTCATTGTATGGTGATGTGGAGATAATGAGTAGCCGATCCAGTAAATCAATAGGGATTCCATGGGGGGACTGGTAGTTCGTGCCACGAATTCTGGTTATTCCTCTGTTTGTGGCCATTATGAGAACAGGGGCCATGTCACTTTCCAAAGCTCGATTCAAGAAGGAGAAGCATTCTATATCCAGCATGTGCACCTCATCTATGAATAGCACACCAGGAATAATCTCAGCCTTCCCTTCCTCTCTCCATTCTGCAACTTTCGCATTGATCTGTTCTCGCACCTCTGATTTAATCTCTCCTGTGTCGCCTGAAAAGAGAGCAAGGGATTCTTTGCGTCCGACTGTTTATCACGTCAATTTCCTGCAGCGACCCCGTATGTACTACCTTCTTGGCCCTTCCTGGAGCTCCCCCGTCGGGGGCAACGAAAACGAAATTTAATCCTGAAAAATTCCCATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATGTGTCCATGGTGTCCGT