ORFeome > s100a10 ORF1 – XORFeome v1.0

s100a10 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: s100a10
Gene ID: 6254353
Gene Page ID: 5915790
ORF Xenbase ID: 17295027

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078507
Original XGC clone length: 288

Human orthology & disease relationships

NCBI Entrez ID: 6281
Ensembl gene IDs: ENSG00000197747
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 233300,260500,608115

Library Location

Plate ID: GDExl11003
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ839677
dbEST ID: 79657379
Trimmed Sequence: ATGGTGGCCCCCTCTGAGCTAGAACATTCCATGGAGAAAATGCTGTTGACTTTCCACAAGTTTGCAGGAGAGAAGAACTACATGAACCGGGACGACCTGCAGAAGCTTCTGGACAGCGAGTTCTCAGAGTTCCTGAAGAACCAAAATGACCCACTGGCCGTGGACAAAATCATGAAGGATCTGGACGACTGCCGCGATGGGCGAGTGTCTTTCCACAGCTTCTTCTCTCTCATAGCCGGCCTCCTCTGCGCCTGCGACGATTATTACGTCAAACACATGAAAGTCTT
Full Trace Sequence: GGGCTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGCCCCCTCTGAGCTAGAACATTCCATGGAGAAAATGCTGTTGACTTTCCACAAGTTTGCAGGAGAGAAGAACTACATGAACCGGGACGACCTGCAGAAGCTTCTGGACAGCGAGTTCTCAGAGTTCCTGAAGAACCAAAATGACCCACTGGCCGTGGACAAAATCATGAAGGATCTGGACGACTGCCGCGATGGGCGAGTGTCTTTCCACAGCTTCTTCTCTCTCATAGCCGGCCTCCTCTGCGCCTGCGACGATTATTACGTCAAACACATGAAAGTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAAAACAAAATCTCACATGTTACAAAACTCGCCCCACGGCGCCGAAAAAAAAAAAATAAAAGCATTCATCAAAACGGGTGGGGCCGAGACCCCCCTGGGAAGAGAAAGGGCCCCGCGCCGAGTGGACACCCCGCGGGAGGGGTATGAAAAAAGGAGGAAAAGCGGGAGAGGGAACATACTCCCGAAACAATTATCACTTTTTTTGCGATTAGGATCCGTGGTCCCGACTTTACCTGTCGACCCATTTGATTTATTCGGGGGCAAACCCCCTCGTTAGAAAGAAAAAAAAAGAGGAACACGAACCCGGCGGGGTGTGGGATGTTTTTATGGGGAGAGGCATGGTCCAGGAAAGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGCCCCCTCTGAGCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839676
dbEST ID: 79657378
Trimmed Sequence: GACTTTCATGTGTTTGACGTAATAATCGTCGCAGGCGCAGAGGAGGCCGGCTATGAGAGAGAAGAAGCTGTGGAAAGACACTCGCCCATCGCGGCAGTCGTCCAGATCCTTCATGATTTTGTCCACGGCCAGTGGGTCATTTTGGTTCTTCAGGAACTCTGAGAACTCGCTGTCCAGAAGCTTCTGCAGGTCGTCCCGGTTCATGTAGTTCTTCTCTCCTGCAAACTTGTGGAAAGTCAACAGCATTTTCTCCATGGAATGTTCTAGCTCAAAGGGGGCCACCATGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACTTTCATGTGTTTGACGTAATAATCGTCGCAGGCGCAGAGGAGGCCGGCTATGAGAGAGAAGAAGCTGTGGAAAGACACTCGCCCATCGCGGCAGTCGTCCAGATCCTTCATGATTTTGTCCACGGCCAGTGGGTCATTTTGGTTCTTCAGGAACTCTGAGAACTCGCTGTCCAGAAGCTTCTGCAGGTCGTCCCGGTTCATGTAGTTCTTCTCTCCTGCAAACTTGTGGAAAGTCAACAGCATTTTCTCCATGGAATGTTCTAGCTCAAAGGGGGCCACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGCCAAAAAAAAACAACGAAATGACTGAAGACAAAGCGCCCGGAACACAAAAAGAAAAAAAAAAAGAAGGGGTTACCAGCACACGGGGTTTTGGTGTGTAACACTATGTGGAGCAGAAGAGCCCGCAAAAACAAAAAGAACCCTGCGGTGTCTGGTGGTGAGGTGGGAGAGAACGCCCCCGGGCGCGGGAGCCACGANACCCACCAATGGGGAACAAAGGNGGGGGGGGGGGGCNGCGCGGGGTGTNGGAGGGGTGGGTAGGATAANGATTTGNGGGNNACANAAGNNNCGGNGGGNANNNANNGNNNANGGGGGGGGGGGGGGGGGGGGGGGGGGNNAANGNGGGGNNNANNGGGGGNGNGAGGGGGGGGNNGGAGGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTTTCATGTGTTTGACGTAATA