ORFeome > s100a11 ORF1 – XORFeome v1.0

s100a11 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: s100a11
Gene ID: 6252115
Gene Page ID: 5784684
ORF Xenbase ID: 17295033

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128955
Original XGC clone length: 657

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ838918
dbEST ID: 79656620
Trimmed Sequence: ATGGCCCAGATGCGCACTACCTCCCCGTCGGAAATGGAGCGCAACATGGAGAAGATCATCGTCATTTTCCAGCGTTTTGCGGGGAAGGACGGCTGCGCCGACACCATGACGTACCAGGAGTTTGAGGACTTCATGAAATCTGAGCTCTGCTCTTTCTCCTGTAACCAGAAGAATAAGGACGTCCTGAAGCAAATGATGAAGTCCGTTGATGGGGGGATGGACAAGAAACCAGACGATAAGTTGGACTTCCAGGAATTCCTCAATCTGATTGGTGGGATGATGGTGGGCTGCCATGCTGCTCTGTGTAAGCTCCCCGAGGGCTACAAGCCCAACCCCTCTAACAAGAAGCCCACGGACATGGAGTCGTCCATGGAGAACATCATTCGCATTTTCCAGAAGTACGCGGGCAAGGGCGGGGACAAGTACCAAATGGACTACAAGGAGTTCGAGAGTTTCATGAAGACGGAGCTGAAAACTTTCACAGAGGGCCAGAAGGACCCCAATATTGTGCAGAACCTGATGAAGCAGATGGACGGCTCGGTGGATGACAAGAAGGACGGACAGATCAACTTCCAGGAGTTCATGAACCTGGTGGGGGGCATCATGGTGTCGTGTCACGAAGCGATGCTGAGGAGCACTCACCCCAAAAAACCCTTGCCAACTTTCCTTGTCAAAGTTTGCAATAGAAAAAAAACATTTGCTTATTCATTTGGTGTAGACGAACAGGGAAAAAAAACA
Full Trace Sequence: CTCGGGGGCGCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCCAGATGCGCACTACCTCCCCGTCGGAAATGGAGCGCAACATGGAGAAGATCATCGTCATTTTCCAGCGTTTTGCGGGGAAGGACGGCTGCGCCGACACCATGACGTACCAGGAGTTTGAGGACTTCATGAAATCTGAGCTCTGCTCTTTCTCCTGTAACCAGAAGAATAAGGACGTCCTGAAGCAAATGATGAAGTCCGTTGATGGGGGGATGGACAAGAAACCAGACGATAAGTTGGACTTCCAGGAATTCCTCAATCTGATTGGTGGGATGATGGTGGGCTGCCATGCTGCTCTGTGTAAGCTCCCCGAGGGCTACAAGCCCAACCCCTCTAACAAGAAGCCCACGGACATGGAGTCGTCCATGGAGAACATCATTCGCATTTTCCAGAAGTACGCGGGCAAGGGCGGGGACAAGTACCAAATGGACTACAAGGAGTTCGAGAGTTTCATGAAGACGGAGCTGAAAACTTTCACAGAGGGCCAGAAGGACCCCAATATTGTGCAGAACCTGATGAAGCAGATGGACGGCTCGGTGGATGACAAGAAGGACGGACAGATCAACTTCCAGGAGTTCATGAACCTGGTGGGGGGCATCATGGTGTCGTGTCACGAAGCGATGCTGAGGAGCACTCACCCCAAAAAACCCTTGCCAACTTTCCTTGTCAAAGTTTGCAATAGAAAAAAAACATTTGCTTATTCATTTGGTGTAGACGAACAGGGAAAAAAAACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCAGATGCGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838917
dbEST ID: 79656619
Trimmed Sequence: GGGTTTCTTGGGGTGAGTGCTCCTCAGCATCGCCTCCTGACACGACACCATGATGCCCCCCACCAGGTTCATGAACTCCTGGAAGTTGATCTGTCCGTCCTTCTTGTCATCCACCGAGCCGTCCATCTGCTTCATCAGGTTCTGCACAATATTGGGGTCCTTCTGGCCCTCTGTGAAAGTTTTCAGCTCCGTCTTCATGAAACTCTCGAACTCCTTGTAGTCCATTTGGTACTTGTCCCCGCCCTTGCCCGCGTACTTCTGGAAAATGCGAATGATGTTCTCCATGGACGACTCCATGTCCGTGGGCTTCTTGTTAGAGGGGTTGGGCTTGTAGCCCTCGGGGAGCTTACACAGAGCAGCATGGCAGCCCACCATCATCCCACCAATCAGATTGAGGAATTCCTGGAAGTCCAACTTATCGTCTGGTTTCTTGTCCATCCCCCCATCAACGGACTTCATCATTTGCTTCAGGACGTCCTTATTCTTCTGGTTACAGGAGAAAGAACAGAGCTCAGATTTCATGAAGTCCTCAAACTCCTGGTACGTCATGGTGTCGGCGCAGCCCTCCTTCCCCGCAAACACCTGGAAAATGACGATAATCATCTCCATGTTCCGCTTCCATTTCCCACGGGAAAGTAATGCGCCACTTGGCCATGGTGGCAAACTTGGTGTTACAAAGTTGCAGTTTTAAAAAACCCATTTCTCAACCAAATAAAAAAAAA
Full Trace Sequence: AACAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGTTTCTTGGGGTGAGTGCTCCTCAGCATCGCCTCCTGACACGACACCATGATGCCCCCCACCAGGTTCATGAACTCCTGGAAGTTGATCTGTCCGTCCTTCTTGTCATCCACCGAGCCGTCCATCTGCTTCATCAGGTTCTGCACAATATTGGGGTCCTTCTGGCCCTCTGTGAAAGTTTTCAGCTCCGTCTTCATGAAACTCTCGAACTCCTTGTAGTCCATTTGGTACTTGTCCCCGCCCTTGCCCGCGTACTTCTGGAAAATGCGAATGATGTTCTCCATGGACGACTCCATGTCCGTGGGCTTCTTGTTAGAGGGGTTGGGCTTGTAGCCCTCGGGGAGCTTACACAGAGCAGCATGGCAGCCCACCATCATCCCACCAATCAGATTGAGGAATTCCTGGAAGTCCAACTTATCGTCTGGTTTCTTGTCCATCCCCCCATCAACGGACTTCATCATTTGCTTCAGGACGTCCTTATTCTTCTGGTTACAGGAGAAAGAACAGAGCTCAGATTTCATGAAGTCCTCAAACTCCTGGTACGTCATGGTGTCGGCGCAGCCCTCCTTCCCCGCAAACACCTGGAAAATGACGATAATCATCTCCATGTTCCGCTTCCATTTCCCACGGGAAAGTAATGCGCCACTTGGCCATGGTGGCAAACTTGGTGTTACAAAGTTGCAGTTTTAAAAAACCCATTTCTCAACCAAATAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGTTTCTTGGGGTGAGT