ORFeome > sall1 ORF1 – XORFeome v1.0

sall1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sall1
Gene ID: 866060
Gene Page ID: 491392
ORF Xenbase ID: 17295075

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC059284
Original XGC clone length: 3450

Human orthology & disease relationships

NCBI Entrez ID: 6299
Ensembl gene IDs: ENSG00000103449
Directly associated (OMIM) disease MIM numbers: 107480
Indirectly associated (Lage, et al.) disease MIM numbers: 107480,113650

Library Location

Plate ID: GDExl11020
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ824667
dbEST ID: 79642369
Trimmed Sequence: ATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATAATCCCACATTGGGTACCTCAGCTATCACAACTTCGCTACCTCAAGTAAGGGATCTGACAGCTTTGGGCAACTTCTCTATGATTAACAGCAATGTCATAATTGAGAACCTTCAGAGCACTAGAGTGGCAGTGGCACAATTCTCCCAAGAAGCCAAAACTAACGGGGCAGCAAACAACAAGTTGGCAGTGCCTGCACTCATGGAGCAGCTCTTGGCTTTACAGCAGCAACAGAATCACCAGTTGCATCTGATTGGACAAATCCGTCACAGACTATTACTGACGGCATCACAGAGTGCAGAGATGCGCACTTTCATCTAGTGGGCCTCAAGGGGGCTTTAAGGGGACCTTGGCACTCCACTGAACTACTTCTAAAATTTCCCTTTTTTTTCCTACCAGGCTGGCTGGCCTCAAACTGGGT
Full Trace Sequence: AAATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAATCTGAACCAGAAGAAATAAAACTAAAGTTTAATCATGAAAGAAGAACAGAGAGGGGTCAAATCCATCGGACGCCCAAGAACAAGGAGGCGCATGTCTGTAGCAGATGTTGTGCAGAGTTCTTTGAACTATCAGATTTGTTGCAACACAAGAAGAACTGCACTAAAAATCAATTGGTTCTAATTGTGAATGAAAATCCACCACCTCCTGCTGAAGCCAGCTCTCCTAGTCTCCCCTCAGATAATCCTGATGAGCACATGAATGACACAGTTAATAACTCAGATCAAGCAGACTGCAGTGACCTTTCAGAGCATGGTGAGCACGGCAAGCCTGACAAAGAAGAATCCATGGAGGTGGAGATTTCGGAAACTAACAATAGCAGCAGTGGTTCTAACAAAGTGGACAATGGTGATTCAAGCAGTAATAATCCCACATTGGGTACCTCAGCTATCACAACTTCGCTACCTCAAGTAAGGGATCTGACAGCTTTGGGCAACTTCTCTATGATTAACAGCAATGTCATAATTGAGAACCTTCAGAGCACTAGAGTGGCAGTGGCACAATTCTCCCAAGAAGCCAAAACTAACGGGGCAGCAAACAACAAGTTGGCAGTGCCTGCACTCATGGAGCAGCTCTTGGCTTTACAGCAGCAACAGAATCACCAGTTGCATCTGATTGGACAAATCCGTCACAGACTATTACTGACGGCATCACAGAGTGCAGAGATGCGCACTTTCATCTAGTGGGCCTCAAGGGGGCTTTAAGGGGACCTTGGCACTCCACTGAACTACTTCTAAAATTTCCCTTTTTTTTCCTACCAGGCTGGCTGGCCTCAAACTGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAATCTGAACCAGAAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ830019
dbEST ID: 79647721
Trimmed Sequence: GGTTCTTACCTTAAGGTTGCCTTTTGTAGTGAATGCCCTTCCACATATAGTGCAGGCAAATGGTTTTTCACCAGTGTGAGTCCGCTCGTGGATTTGTAAAGCACTGGAAGAAGAGAATGATTTCCCACATGCATGGCAGTAATGCTGCTTAGGAGTCCTTCTGGCCAAAGCAGGAAGCAGAACTGGTGACGTGGCAGAAGATGGCAGAGATCCTGATGAAACTATGTTTGTTGTAGGCTGTTCTTTAATGTCCTGAGAAGAGCCATGCATGAAACCATTAAACTCAGTCTTTATTATAGTTGCCAGAGGGTTAGAAGGTGCTGAGGGAATTGTTGGGTTTGGTGTCATACTGGAACTGGGTTCAAAGAGTTGTGATGGTAGATCCCTCATCTGGTGAGTGAGCATATGCTGTTTCAAATTGCCCTTTGTTGAAAAGCCACGATTGCAGACTGTGCAAATAAATGGTCTTTCTTTGGTATGGCTTCTATAATGAATGTCCAAGGCACTCTGACATGCAAAGGTTTTGCCACAAATATCACATATAGTGTTTTTATATTTACACCGATCTCTGAAAGGGATAGCACACCTAAAGGTTCTTCTTTGATCACTTTATCTGTGTTACTAGATGTCAAGTCCAAGCCCCTCCTTAACAGGTGTAGGGGACAATCCATTGGTTGGGTCACAAAAAACAACTCGCTGAAAACTCCCCTCCTGGTTTGGGGGAATTTCAAATATCCAATTTGTCCTTTTAAAAGGAAAAAAACCAAGC
Full Trace Sequence: GAGGGAAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGTTCTTACCTTAAGGTTGCCTTTTGTAGTGAATGCCCTTCCACATATAGTGCAGGCAAATGGTTTTTCACCAGTGTGAGTCCGCTCGTGGATTTGTAAAGCACTGGAAGAAGAGAATGATTTCCCACATGCATGGCAGTAATGCTGCTTAGGAGTCCTTCTGGCCAAAGCAGGAAGCAGAACTGGTGACGTGGCAGAAGATGGCAGAGATCCTGATGAAACTATGTTTGTTGTAGGCTGTTCTTTAATGTCCTGAGAAGAGCCATGCATGAAACCATTAAACTCAGTCTTTATTATAGTTGCCAGAGGGTTAGAAGGTGCTGAGGGAATTGTTGGGTTTGGTGTCATACTGGAACTGGGTTCAAAGAGTTGTGATGGTAGATCCCTCATCTGGTGAGTGAGCATATGCTGTTTCAAATTGCCCTTTGTTGAAAAGCCACGATTGCAGACTGTGCAAATAAATGGTCTTTCTTTGGTATGGCTTCTATAATGAATGTCCAAGGCACTCTGACATGCAAAGGTTTTGCCACAAATATCACATATAGTGTTTTTATATTTACACCGATCTCTGAAAGGGATAGCACACCTAAAGGTTCTTCTTTGATCACTTTATCTGTGTTACTAGATGTCAAGTCCAAGCCCCTCCTTAACAGGTGTAGGGGACAATCCATTGGTTGGGTCACAAAAAACAACTCGCTGAAAACTCCCCTCCTGGTTTGGGGGAATTTCAAATATCCAATTTGTCCTTTTAAAAGGAAAAAAACCAAGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTTCTTACCTTAAGGTTGCCTTT