ORFeome > sap30l ORF1 – XORFeome v1.0

sap30l ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sap30l
Gene ID: 6253617
Gene Page ID: 960201
ORF Xenbase ID: 17295141

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044334
Original XGC clone length: 525

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ823736
dbEST ID: 79641438
Trimmed Sequence: ATGAACGGATTCAGCACGGAGGAGGATAGTCGTGATGGGCCCCCGGCCCAGGCTGCACCTTTCTTTGGACAGACCTGCTGTCTGATAGACGGAGGAGAGCGCTGTCCTCGGCCCGCTGGGAACGCGTCGTTCAGTAAGAGAGTGCAGAAGAGCATCTCGCAGAAAAAACTCAAACTGGACATCGATAAGAATGTTCGGCACCTCTACATATGTGACTTTCACAAAAATTACATCCAGAGTGTTAGGAACAAAAGAAAGCGTAAAACCAGTGATGACGGGGGGGATTCTCCAGAGCACGAAACAGATATCCCAGAGGTGGATCTGTTTCAGCTGCAAGTGAACACACTGCGCAGATACAAGAGATATTACAAGCTGCAGACTCGTCCTGGACTTAACAAGGCCCAGCTTGCAGAGGTGCTCTTTAATTCTGAAAGGACTTTGATAAATGTTGTTCATGAAACCAAGTTTTTAATTAATAAAATAATTAAAGGGGTTGTTCACCTTTCAAACACTTTTATCAGTTT
Full Trace Sequence: GGCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACGGATTCAGCACGGAGGAGGATAGTCGTGATGGGCCCCCGGCCCAGGCTGCACCTTTCTTTGGACAGACCTGCTGTCTGATAGACGGAGGAGAGCGCTGTCCTCGGCCCGCTGGGAACGCGTCGTTCAGTAAGAGAGTGCAGAAGAGCATCTCGCAGAAAAAACTCAAACTGGACATCGATAAGAATGTTCGGCACCTCTACATATGTGACTTTCACAAAAATTACATCCAGAGTGTTAGGAACAAAAGAAAGCGTAAAACCAGTGATGACGGGGGGGATTCTCCAGAGCACGAAACAGATATCCCAGAGGTGGATCTGTTTCAGCTGCAAGTGAACACACTGCGCAGATACAAGAGATATTACAAGCTGCAGACTCGTCCTGGACTTAACAAGGCCCAGCTTGCAGAGGTGCTCTTTAATTCTGAAAGGACTTTGATAAATGTTGTTCATGAAACCAAGTTTTTAATTAATAAAATAATTAAAGGGGTTGTTCACCTTTCAAACACTTTTATCAGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAATATCCCTGTAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGGATTCAGCACGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829045
dbEST ID: 79646747
Trimmed Sequence: ACTGATAAAAGTGTTTGAAAGGTGAACAACCCCTTTAATTATTTTATTAATTAAAAACTTGGTTTCATGAACAACATTTATCAAAGTCCTTTCAGAATTAAAGAGCACCTCTGCAAGCTGGGCCTTGTTAAGTCCAGGACGAGTCTGCAGCTTGTAATATCTCTTGTATCTGCGCAGTGTGTTCACTTGCAGCTGAAACAGATCCACCTCTGGGATATCTGTTTCGTGCTCTGGAGAATCCCCCCCGTCATCACTGGTTTTACGCTTTCTTTTGTTCCTAACACTCTGGATGTAATTTTTGTGAAAGTCACATATGTAGAGGTGCCGAACATTCTTATCGATGTCCAGTTTGAGTTTTTTCTGCGAGATGCTCTTCTGCACTCTCTTACTGAACGACGCGTTCCCAGCGGGCCGAGGACAGCGCTCTCCTCCGTCTATCAGACAGCAGGTCTGTCCAAAGAAAGGTGCAGCCTGGGCCGGGGGCCCATCACGACTATCCTCCTCCGTGCTGAATCCGTTCATGG
Full Trace Sequence: GCTGCCGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTGATAAAAGTGTTTGAAAGGTGAACAACCCCTTTAATTATTTTATTAATTAAAAACTTGGTTTCATGAACAACATTTATCAAAGTCCTTTCAGAATTAAAGAGCACCTCTGCAAGCTGGGCCTTGTTAAGTCCAGGACGAGTCTGCAGCTTGTAATATCTCTTGTATCTGCGCAGTGTGTTCACTTGCAGCTGAAACAGATCCACCTCTGGGATATCTGTTTCGTGCTCTGGAGAATCCCCCCCGTCATCACTGGTTTTACGCTTTCTTTTGTTCCTAACACTCTGGATGTAATTTTTGTGAAAGTCACATATGTAGAGGTGCCGAACATTCTTATCGATGTCCAGTTTGAGTTTTTTCTGCGAGATGCTCTTCTGCACTCTCTTACTGAACGACGCGTTCCCAGCGGGCCGAGGACAGCGCTCTCCTCCGTCTATCAGACAGCAGGTCTGTCCAAAGAAAGGTGCAGCCTGGGCCGGGGGCCCATCACGACTATCCTCCTCCGTGCTGAATCCGTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCAACAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTAATTTAAAAACAGAACTAAAAACTGGCCGTCGTTTAAACCAAACAGGGGAACCCGGGAAANNNTCCNAAGCCACCCACAGGGCCCGCGGAACACCAAAANACANAGGAAAATGTAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGATAAAAGTGTTTGAAAGGTG