ORFeome > sat1 ORF1 – XORFeome v1.0

sat1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sat1
Gene ID: 6255845
Gene Page ID: 1002780
ORF Xenbase ID: 17295189

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129748
Original XGC clone length: 516

Human orthology & disease relationships

NCBI Entrez ID: 6303
Ensembl gene IDs: ENSG00000130066
Directly associated (OMIM) disease MIM numbers: 308800
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,139300,146800,194050,207800,230350,231300,238970,266140,268300,270200,300000,311250,600121,604232,607765,608643,608902,609535,609924

Library Location

Plate ID: GDExl11092
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ838934
dbEST ID: 79656636
Trimmed Sequence: ATGGCCAAGTTTATCATACGATCCGCTAATGCCGGGGACTGTAAAGATATATTGCGACTCATAAAGGAACTGGCTAAATATGAAGAGATGGAGAACCAAGTAGTCCTAACTGAGAAAGATCTGCTTGATGATGGATTTGGAGAACATCCATTTTACTGCTGTCTTGATGCTGAAGAGCCTAAGGAGACACACAGAGTTGATGAACAACCAGATGATGGGAGTGATGCGTCTGACTTTTGACTGGAGACACCAGATGGAGAAATCGTCCTGTGTGATAAAATAATTATAGGAGGCGAAATGGATAGGCAGAGATAATGTATGTGAGAAGGAGCGTGGTTGGATCGAGAACATGCTGAAAAACATGGTTTCAGAGCAAAAGTATCTTGGAGGCTCTTCACTTATATGCACGATGGCAGGCTGAAGGAGGCCTCGATTCACGAGCTGAAGAAAACTTGAACTATTGCAGAGTACTGGGGTCGACCACAGACCGAGATAAGAAAGATTGTTGTTGGGAGAAGAGGGGGCTAGGCACGCTATGACGCAAAAAAGGAGATGGGGCAATGAAAAAACGCACTGCGGTTAGATGGGTGTATGGGAAAAAATGATTGAATTTTCAAACAGGGGAGGATCATTAAATGCAGGGAGTGGAAAAAAAAACCCTTGTCGATGGAGGGTTCTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTGAAAACCACAAGGGCGGAGGAGCCAAAAGNNTCTTGGGGGCTAGGGAGGATGCGTAGAGGTTGAGAACGACGGAGCGAAGAAAAAAGAAATGAAAAATTGGGAGGGAG
Full Trace Sequence: GCTCGGGGCCCAAATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAAGTTTATCATACGATCCGCTAATGCCGGGGACTGTAAAGATATATTGCGACTCATAAAGGAACTGGCTAAATATGAAGAGATGGAGAACCAAGTAGTCCTAACTGAGAAAGATCTGCTTGATGATGGATTTGGAGAACATCCATTTTACTGCTGTCTTGATGCTGAAGAGCCTAAGGAGACACACAGAGTTGATGAACAACCAGATGATGGGAGTGATGCGTCTGACTTTTGACTGGAGACACCAGATGGAGAAATCGTCCTGTGTGATAAAATAATTATAGGAGGCGAAATGGATAGGCAGAGATAATGTATGTGAGAAGGAGCGTGGTTGGATCGAGAACATGCTGAAAAACATGGTTTCAGAGCAAAAGTATCTTGGAGGCTCTTCACTTATATGCACGATGGCAGGCTGAAGGAGGCCTCGATTCACGAGCTGAAGAAAACTTGAACTATTGCAGAGTACTGGGGTCGACCACAGACCGAGATAAGAAAGATTGTTGTTGGGAGAAGAGGGGGCTAGGCACGCTATGACGCAAAAAAGGAGATGGGGCAATGAAAAAACGCACTGCGGTTAGATGGGTGTATGGGAAAAAATGATTGAATTTTCAAACAGGGGAGGATCATTAAATGCAGGGAGTGGAAAAAAAAACCCTTGTCGATGGAGGGTTCTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTGAAAACCACAAGGGCGGAGGAGCCAAAAGNNTCTTGGGGGCTAGGGAGGATGCGTAGAGGTTGAGAACGACGGAGCGAAGAAAAAAGAAATGAAAAATTGGGAGGGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAAGTTTATCATACGATCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838933
dbEST ID: 79656635
Trimmed Sequence: CTCTTCTGAGGCAAGTTTACACAAGTAGTCTTTATCGATTTTGAAGAGGCGCCATCCTTCTTCTGTAGAAAGGTCAGATGCTCCACGTCTCTTGTAGAACTTTATGGACGGCTCGTTCCATTCTGCAACCAGGAAGTGCATGCTGCTGCAACGGGTCTTCATCGCAATTTGACTCAAGTGCTTGAATATCTCTGATCCAATGCCAAACCCTCTGTACTCATCCATCACAAAGAAGTCTTCCAAATAAAGCAATTTTCCAATCCATGGGTCATAGGTAAAGTAGTACATTGCAAACCCAACAACTGTGTATCCATCAACGCTCTGGGTCTCCTTAGGCACTTCAGCAACAAGACAGTGGTAAAATGGATGTTCTCCAAATCCATCTTCAAGCAGATCTTTCTCAGTTAGGACTACTTGGTTCTCCATCTCTTCATATTTAGCCAGTTCCTTTATGAGTCGCAATATATCTTTACAGTCCCCGGCATTAGCGGATCGTATGATAAACTTGGCCATGG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTTCTGAGGCAAGTTTACACAAGTAGTCTTTATCGATTTTGAAGAGGCGCCATCCTTCTTCTGTAGAAAGGTCAGATGCTCCACGTCTCTTGTAGAACTTTATGGACGGCTCGTTCCATTCTGCAACCAGGAAGTGCATGCTGCTGCAACGGGTCTTCATCGCAATTTGACTCAAGTGCTTGAATATCTCTGATCCAATGCCAAACCCTCTGTACTCATCCATCACAAAGAAGTCTTCCAAATAAAGCAATTTTCCAATCCATGGGTCATAGGTAAAGTAGTACATTGCAAACCCAACAACTGTGTATCCATCAACGCTCTGGGTCTCCTTAGGCACTTCAGCAACAAGACAGTGGTAAAATGGATGTTCTCCAAATCCATCTTCAAGCAGATCTTTCTCAGTTAGGACTACTTGGTTCTCCATCTCTTCATATTTAGCCAGTTCCTTTATGAGTCGCAATATATCTTTACAGTCCCCGGCATTAGCGGATCGTATGATAAACTTGGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGACCCGAACAAAAGAAGGAACAACCATTTACAGCCCCCAAAAACGGGGGGAANNNNCNNAANNNCCNCGTAAACAGANNNNCGGAAGGGCGGCGGNNGGNGGCAACAGNNGGNNGNGGGAAGGAGAAGGACCCGGGANANAGGGGAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTCTGAGGCAAGTTTACACAA