ORFeome > sbds ORF1 – XORFeome v1.0

sbds ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sbds
Gene ID: 1003512
Gene Page ID: 1003505
ORF Xenbase ID: 17295213

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141736
Original XGC clone length: 753

Human orthology & disease relationships

NCBI Entrez ID: 51119
Ensembl gene IDs: ENSG00000126524,LRG_104
Directly associated (OMIM) disease MIM numbers: 260400
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ838886
dbEST ID: 79656588
Trimmed Sequence: ATGTCAATCTTTACTCCAACCAACCAGATCCGCCTCACCAATGTCGCGGTGGTGCGAATGAAGAAAGGAGGGAAGAGATTTGAGATTGCCTGCTACAAAAATAAAGTCATGAGCTGGAGAAGTGGAGCTGAAAAAGATCTAGATGAAGTATTGCAAACTCACTCTGTATTTATGAATGTATCTAAAGGCCAGGGAGCTAAAAAAGAAGATCTTCTCAAAGCATTCGGCACTGAAGACCAGACAGAAATCTGCAAGCAGATTTTATCTAAAGGAGAACTGCAGGTGTCTGAAAAGGAGCGGAGCACACAGTTAGAACAGATGTTTCGAGATATTGCAACAATTGTGGCAGACAAGTGTGTAAATCCAGAGACAAAGAGGCCTTACACTGTTAACCTGATTGAACGAGCAATGAAAGATATCCACTACTCGGTGAAAGCAACCAAGAGCACCAAGCAACAGGCATTAGATGTTATCAAGCAGCTGAAAGAGACCATGCAGATTGAAAGAGCCCACATGAGACTGCGTTTTATTGTACCAGCCAAGGATGGAAAGAAATTGAAAGAGAAACTGAAGCCTCCTATAAAGCACATAGAAAGTGAGAACTTTGATCAAGAGCTGGGAATTGTTTGCTTAATTGGATCTGGGTGCTTTCAAAAAATTTAAGAAATTAATACCCTGTTGAAACAAGGGAAAAGGGAATCTTGGAATTTCTCAATCTAAAAAATTTAAAAAAAGGGCGAAAGAAAAAATTTAGATTTGCCCACGTTTGCTTTTACCAAGAGTTGGGGTTTTAAAAAGAGAACCA
Full Trace Sequence: GGGTCTCTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAATCTTTACTCCAACCAACCAGATCCGCCTCACCAATGTCGCGGTGGTGCGAATGAAGAAAGGAGGGAAGAGATTTGAGATTGCCTGCTACAAAAATAAAGTCATGAGCTGGAGAAGTGGAGCTGAAAAAGATCTAGATGAAGTATTGCAAACTCACTCTGTATTTATGAATGTATCTAAAGGCCAGGGAGCTAAAAAAGAAGATCTTCTCAAAGCATTCGGCACTGAAGACCAGACAGAAATCTGCAAGCAGATTTTATCTAAAGGAGAACTGCAGGTGTCTGAAAAGGAGCGGAGCACACAGTTAGAACAGATGTTTCGAGATATTGCAACAATTGTGGCAGACAAGTGTGTAAATCCAGAGACAAAGAGGCCTTACACTGTTAACCTGATTGAACGAGCAATGAAAGATATCCACTACTCGGTGAAAGCAACCAAGAGCACCAAGCAACAGGCATTAGATGTTATCAAGCAGCTGAAAGAGACCATGCAGATTGAAAGAGCCCACATGAGACTGCGTTTTATTGTACCAGCCAAGGATGGAAAGAAATTGAAAGAGAAACTGAAGCCTCCTATAAAGCACATAGAAAGTGAGAACTTTGATCAAGAGCTGGGAATTGTTTGCTTAATTGGATCTGGGTGCTTTCAAAAAATTTAAGAAATTAATACCCTGTTGAAACAAGGGAAAAGGGAATCTTGGAATTTCTCAATCTAAAAAATTTAAAAAAAGGGCGAAAGAAAAAATTTAGATTTGCCCACGTTTGCTTTTACCAAGAGTTGGGGTTTTAAAAAGAGAACCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAATCTTTACTCCAACCAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838885
dbEST ID: 79656587
Trimmed Sequence: CTCAAACTTCTCATCGCCTTCTTCTACATCTTTCAGACTGAGAACTTCAAGAGTGCCTTTTCCCTTGGTCTCACAGCGTATTAACTCATCAATTTCTCTGAAGCAACCAGGATCAATTAAGCAAACAATTTCCAGCTCTTGATCAAAGTTCTCACTTTCTATGTGCTTTATTAGAGGCTTCAGTTTCTCTTTCAATTTCTTTCCATCCTTGGCTGGTACAATAAAACGCAGTCTCATGTGGGCTCTTTCAATCTGCATGGTCTCTTTCAGCTGCTTGATAACATCTAATGCCTGTTGCTTGGTGCTCTTGGTTGCTTTCACCGAGTAGTGGATATCTTTCATTGCTCGTTCAATCAGGTTAACAGTGTAAGGCCTCTTTGTCTCTGGATTTACACACTTGTCTGCCACAATTGTTGCAATATCTCGAAACATCTGTTCTAACTGTGTGCTCCGCTCCTTTTCATACACCTGCAGTTCTCCTTTAGATAAAATCTGCTTGCAGATTTCTGTCTGGTCTTCAGTGCCGAATGCTTTGAGAAGATCTTCTTTTTAACCTCCCTGGGCCTTAGATAATTTATAAATTCCAAAGGAGGTTTGCAGAACTCATCTAGAATCTTTTTCGCTTCCCTTCTCCCGCCTCAAGACCTTTATTTTTTAACAGGCAATCGCAAATTCTCATCCCCTCCTTTCTTCATTTCCCCCAAACCCCGAACTTTTGGTGAAGGGGGAATACGGGGTGGGGTTGGGAGGAGAAAAAATAGAAAAGGGTT
Full Trace Sequence: GGGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAAACTTCTCATCGCCTTCTTCTACATCTTTCAGACTGAGAACTTCAAGAGTGCCTTTTCCCTTGGTCTCACAGCGTATTAACTCATCAATTTCTCTGAAGCAACCAGGATCAATTAAGCAAACAATTTCCAGCTCTTGATCAAAGTTCTCACTTTCTATGTGCTTTATTAGAGGCTTCAGTTTCTCTTTCAATTTCTTTCCATCCTTGGCTGGTACAATAAAACGCAGTCTCATGTGGGCTCTTTCAATCTGCATGGTCTCTTTCAGCTGCTTGATAACATCTAATGCCTGTTGCTTGGTGCTCTTGGTTGCTTTCACCGAGTAGTGGATATCTTTCATTGCTCGTTCAATCAGGTTAACAGTGTAAGGCCTCTTTGTCTCTGGATTTACACACTTGTCTGCCACAATTGTTGCAATATCTCGAAACATCTGTTCTAACTGTGTGCTCCGCTCCTTTTCATACACCTGCAGTTCTCCTTTAGATAAAATCTGCTTGCAGATTTCTGTCTGGTCTTCAGTGCCGAATGCTTTGAGAAGATCTTCTTTTTAACCTCCCTGGGCCTTAGATAATTTATAAATTCCAAAGGAGGTTTGCAGAACTCATCTAGAATCTTTTTCGCTTCCCTTCTCCCGCCTCAAGACCTTTATTTTTTAACAGGCAATCGCAAATTCTCATCCCCTCCTTTCTTCATTTCCCCCAAACCCCGAACTTTTGGTGAAGGGGGAATACGGGGTGGGGTTGGGAGGAGAAAAAATAGAAAAGGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAAACTTCTCATCGCCT